Incidental Mutation 'R4879:Snapc4'
ID375105
Institutional Source Beutler Lab
Gene Symbol Snapc4
Ensembl Gene ENSMUSG00000036281
Gene Namesmall nuclear RNA activating complex, polypeptide 4
Synonyms5730436L13Rik
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26362765-26380653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26365992 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 840 (S840N)
Ref Sequence ENSEMBL: ENSMUSP00000109750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035427] [ENSMUST00000114115]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035427
AA Change: S832N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281
AA Change: S832N

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114115
AA Change: S840N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281
AA Change: S840N

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123934
SMART Domains Protein: ENSMUSP00000122456
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
SANT 47 99 3.05e-9 SMART
SANT 102 151 8.24e-15 SMART
SANT 154 203 7.8e-16 SMART
low complexity region 218 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150121
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of the small nuclear RNA-activating protein (SNAP) complex. The encoded protein contains a Myb DNA-binding domain, and is essential for RNA polymerase II and III polymerase transcription from small nuclear RNA promoters. A mutation in this gene is associated with ankylosing spondylitis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,219,700 Y541F probably damaging Het
Acot12 T A 13: 91,762,964 V136E probably benign Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Itgb5 G C 16: 33,875,978 G180R probably damaging Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smad4 A G 18: 73,641,903 C442R probably damaging Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Wtap A G 17: 12,969,435 Y193H probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Snapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Snapc4 APN 2 26369312 missense probably benign
IGL01730:Snapc4 APN 2 26363724 splice site probably null
IGL01958:Snapc4 APN 2 26366440 unclassified probably benign
IGL02354:Snapc4 APN 2 26367307 unclassified probably benign
IGL02425:Snapc4 APN 2 26368200 missense probably damaging 1.00
IGL02812:Snapc4 APN 2 26369372 missense probably benign 0.03
IGL02951:Snapc4 APN 2 26370835 missense probably benign 0.33
R0011:Snapc4 UTSW 2 26364813 missense probably benign 0.03
R0409:Snapc4 UTSW 2 26367216 missense probably benign 0.37
R0932:Snapc4 UTSW 2 26374646 missense probably damaging 1.00
R1674:Snapc4 UTSW 2 26376197 missense probably benign
R1878:Snapc4 UTSW 2 26376153 critical splice donor site probably null
R3722:Snapc4 UTSW 2 26365428 missense probably benign
R3886:Snapc4 UTSW 2 26365498 nonsense probably null
R3887:Snapc4 UTSW 2 26365498 nonsense probably null
R3888:Snapc4 UTSW 2 26365498 nonsense probably null
R3889:Snapc4 UTSW 2 26365498 nonsense probably null
R4638:Snapc4 UTSW 2 26365302 missense probably damaging 1.00
R4663:Snapc4 UTSW 2 26374181 missense possibly damaging 0.77
R4922:Snapc4 UTSW 2 26369233 missense probably benign
R5385:Snapc4 UTSW 2 26374503 missense probably benign 0.44
R5525:Snapc4 UTSW 2 26369526 small deletion probably benign
R5762:Snapc4 UTSW 2 26378606 missense probably damaging 1.00
R5839:Snapc4 UTSW 2 26365534 missense probably benign 0.01
R6300:Snapc4 UTSW 2 26378551 missense probably benign 0.14
R6422:Snapc4 UTSW 2 26368303 missense probably benign 0.00
R6843:Snapc4 UTSW 2 26373599 missense probably benign 0.03
R7044:Snapc4 UTSW 2 26369953 missense probably damaging 1.00
R7341:Snapc4 UTSW 2 26369261 missense probably benign 0.01
R7727:Snapc4 UTSW 2 26373434 missense probably damaging 1.00
R7941:Snapc4 UTSW 2 26376718 missense probably damaging 0.98
R8277:Snapc4 UTSW 2 26365710 missense probably benign 0.05
R8311:Snapc4 UTSW 2 26378534 missense probably benign
R8323:Snapc4 UTSW 2 26364699 missense probably benign 0.15
X0010:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0011:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0014:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0017:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0021:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0023:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0028:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0033:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0064:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0067:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
Z1176:Snapc4 UTSW 2 26368222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGCTGTTGAGACCAAG -3'
(R):5'- AGCCAGTCTTTCATAGTCGG -3'

Sequencing Primer
(F):5'- CTGTTGAGACCAAGAGCCTG -3'
(R):5'- CAGTCTTTCATAGTCGGGCTGC -3'
Posted On2016-03-17