Incidental Mutation 'R4879:Abca6'
ID375153
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110219700 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 541 (Y541F)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: Y541F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: Y541F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Meta Mutation Damage Score 0.1390 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 T A 13: 91,762,964 V136E probably benign Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Itgb5 G C 16: 33,875,978 G180R probably damaging Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smad4 A G 18: 73,641,903 C442R probably damaging Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Snapc4 C T 2: 26,365,992 S840N possibly damaging Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Wtap A G 17: 12,969,435 Y193H probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R7925:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7938:Abca6 UTSW 11 110191628 missense probably benign 0.01
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCAACCTCTTGCTCTACG -3'
(R):5'- CATTTCCCAGATTTCACAGGAATCAC -3'

Sequencing Primer
(F):5'- GCTCTACGTCCTGTGGAAGAATC -3'
(R):5'- TGCTATCTCAGAGAGAACGTGCTAC -3'
Posted On2016-03-17