Incidental Mutation 'R4879:Acot12'
ID375158
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91762964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 136 (V136E)
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably benign
Transcript: ENSMUST00000022120
AA Change: V136E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620
AA Change: V136E

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161337
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,219,700 Y541F probably damaging Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Itgb5 G C 16: 33,875,978 G180R probably damaging Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smad4 A G 18: 73,641,903 C442R probably damaging Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Snapc4 C T 2: 26,365,992 S840N possibly damaging Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Wtap A G 17: 12,969,435 Y193H probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0331:Acot12 UTSW 13 91760064 critical splice donor site probably null
R0525:Acot12 UTSW 13 91760067 splice site probably benign
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3736:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4156:Acot12 UTSW 13 91784763 missense probably benign 0.00
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R5456:Acot12 UTSW 13 91741640 missense probably damaging 1.00
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
R7869:Acot12 UTSW 13 91771725 missense probably benign 0.12
R7952:Acot12 UTSW 13 91771725 missense probably benign 0.12
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCCAGAATGTTTCATGAAATCAC -3'
(R):5'- GTTCTCAGGAATGGCTCGCTTC -3'

Sequencing Primer
(F):5'- TCACCAATAAACAGTCCATTTACTTG -3'
(R):5'- AGGAATGGCTCGCTTCATCTC -3'
Posted On2016-03-17