Incidental Mutation 'R4879:Wtap'
ID375169
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12969435 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 193 (Y193H)
Ref Sequence ENSEMBL: ENSMUSP00000124205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159551] [ENSMUST00000159986] [ENSMUST00000160781]
Predicted Effect probably damaging
Transcript: ENSMUST00000007007
AA Change: Y193H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: Y193H

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159551
AA Change: Y193H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: Y193H

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159986
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160781
SMART Domains Protein: ENSMUSP00000124138
Gene: ENSMUSG00000060475

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Meta Mutation Damage Score 0.2596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,219,700 Y541F probably damaging Het
Acot12 T A 13: 91,762,964 V136E probably benign Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Itgb5 G C 16: 33,875,978 G180R probably damaging Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smad4 A G 18: 73,641,903 C442R probably damaging Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Snapc4 C T 2: 26,365,992 S840N possibly damaging Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7324:Wtap UTSW 17 12980946 missense possibly damaging 0.91
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
R7939:Wtap UTSW 17 12981796 nonsense probably null
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCACTCTTTTAACATTCAATGG -3'
(R):5'- TCTGTACGTGTTGATGCTCCAG -3'

Sequencing Primer
(F):5'- AATGGTTTTGTTTCATAAGTCAATGG -3'
(R):5'- CAAAGGCTAGAGAGAGCTTTGTCTTC -3'
Posted On2016-03-17