Incidental Mutation 'R4879:Smad4'
ID375177
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 042488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4879 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73641903 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 442 (C442R)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025393
AA Change: C442R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: C442R

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114939
AA Change: C442R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: C442R

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147315
Meta Mutation Damage Score 0.9600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (86/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,219,700 Y541F probably damaging Het
Acot12 T A 13: 91,762,964 V136E probably benign Het
Aftph A G 11: 20,698,311 probably null Het
Ambra1 C T 2: 91,772,694 probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano9 T C 7: 141,110,502 D73G probably benign Het
Asap3 G A 4: 136,242,664 D778N probably benign Het
Atp8a2 G T 14: 60,008,469 Y591* probably null Het
BC067074 T C 13: 113,319,787 I789T probably benign Het
Blk T C 14: 63,375,965 T365A probably benign Het
C4b G T 17: 34,743,647 S27Y probably damaging Het
C6 G T 15: 4,803,647 probably null Het
Ccdc33 T A 9: 58,067,556 I345F possibly damaging Het
Cetn3 T A 13: 81,792,149 probably benign Het
Cntn3 T A 6: 102,267,428 I387L possibly damaging Het
Cog8 A G 8: 107,056,352 C102R probably damaging Het
Cyp2c55 CA C 19: 39,042,078 probably null Het
Dmxl1 C T 18: 49,889,467 A1624V probably damaging Het
Dnah1 T G 14: 31,300,748 E1144A possibly damaging Het
Dnah12 T A 14: 26,718,046 probably null Het
Dnah2 G A 11: 69,476,691 T1794I probably damaging Het
Erbin A T 13: 103,834,774 M778K probably benign Het
Fam189a2 T C 19: 23,975,655 probably null Het
Fbxw10 G T 11: 62,847,747 A156S probably damaging Het
Flnc T A 6: 29,460,806 F2632Y probably damaging Het
Frmd4a A G 2: 4,529,817 K160E probably damaging Het
Glipr1l2 A G 10: 112,107,124 K295E probably benign Het
Gm10651 T C 7: 27,949,343 noncoding transcript Het
Gm15292 T A 8: 21,250,364 L62Q probably damaging Het
Gm7257 G A 9: 36,432,793 C24Y probably damaging Het
Herc1 T A 9: 66,462,837 C465* probably null Het
Hoxb4 A G 11: 96,320,188 I205V probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il1f6 A G 2: 24,216,020 N29S probably benign Het
Ilk A G 7: 105,741,804 S292G probably benign Het
Itgb5 G C 16: 33,875,978 G180R probably damaging Het
Kcnip4 T C 5: 48,409,865 D120G possibly damaging Het
Kin A G 2: 10,080,644 D5G probably benign Het
Lrrtm2 C A 18: 35,213,319 G310V probably damaging Het
Med1 T C 11: 98,155,360 probably benign Het
Mepce C A 5: 137,785,282 probably benign Het
Nckipsd T A 9: 108,813,915 probably benign Het
Notch3 T A 17: 32,147,963 Q866L probably benign Het
Olfr1051 A T 2: 86,275,763 C241* probably null Het
Olfr1157 A T 2: 87,962,696 H65Q possibly damaging Het
Olfr547 A T 7: 102,534,755 T3S probably benign Het
Orai1 T C 5: 123,011,831 probably benign Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Pcnx4 G A 12: 72,567,185 D635N probably damaging Het
Pex5 T C 6: 124,398,363 I567V probably benign Het
Ppfibp2 T C 7: 107,729,183 S485P probably benign Het
Pqlc2 A T 4: 139,301,784 probably null Het
Sbno1 T C 5: 124,404,024 Y356C probably damaging Het
Sdcbp T C 4: 6,381,056 I67T possibly damaging Het
Slc5a7 A G 17: 54,276,651 I537T probably benign Het
Smpd5 A G 15: 76,294,870 H146R possibly damaging Het
Snai2 A G 16: 14,706,741 Y37C probably benign Het
Snapc4 C T 2: 26,365,992 S840N possibly damaging Het
Stpg2 T C 3: 139,215,373 I113T probably benign Het
Tbc1d32 T C 10: 56,049,029 probably null Het
Tfg A T 16: 56,701,157 S39R probably damaging Het
Thsd7b T A 1: 130,188,499 S1330T possibly damaging Het
Tnfaip3 T C 10: 19,005,573 T322A probably benign Het
Tpra1 A G 6: 88,911,709 Y291C probably damaging Het
Trcg1 A G 9: 57,246,720 D658G probably damaging Het
Trip4 C T 9: 65,875,022 V143I probably benign Het
Trp53bp1 T C 2: 121,202,603 K1691E probably damaging Het
Ttc8 T A 12: 98,942,303 M77K possibly damaging Het
Tubb2a A T 13: 34,074,589 M406K probably benign Het
Txnrd1 T A 10: 82,881,917 probably null Het
Ugt2a3 C A 5: 87,331,285 R268L probably benign Het
Usp34 T G 11: 23,373,410 M982R possibly damaging Het
Vmn2r43 T A 7: 8,255,103 K370N probably benign Het
Vopp1 A T 6: 57,762,370 probably benign Het
Vps11 A C 9: 44,353,300 C660G probably benign Het
Wnk1 T C 6: 119,949,377 H1137R probably damaging Het
Wtap A G 17: 12,969,435 Y193H probably damaging Het
Zfp462 T A 4: 55,009,444 V470D probably benign Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
R7450:Smad4 UTSW 18 73677853 missense probably damaging 1.00
R7524:Smad4 UTSW 18 73675871 missense probably damaging 1.00
R8001:Smad4 UTSW 18 73641810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGAGGTTACAAGTCACCAC -3'
(R):5'- CACGGATCTGTTCCAAACACTG -3'

Sequencing Primer
(F):5'- AGGTTACAAGTCACCACTGTACTCTG -3'
(R):5'- CCTGGGACTGCAGTTACATAGTTAC -3'
Posted On2016-03-17