Incidental Mutation 'R4880:Galnt13'
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55060572 bp
Amino Acid Change Glutamine to Lysine at position 422 (Q422K)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect probably damaging
Transcript: ENSMUST00000068595
AA Change: Q422K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: Q422K

transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112634
AA Change: Q422K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: Q422K

transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112635
AA Change: Q422K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: Q422K

transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112636
AA Change: Q422K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: Q422K

transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-03-17