Incidental Mutation 'R4880:Tenm4'
ID 375217
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms Doc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4880 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 96171246-96911093 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 96905818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107162] [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107165] [ENSMUST00000107165] [ENSMUST00000107166] [ENSMUST00000107166] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000107162
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107162
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107162
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107165
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107165
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107165
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107166
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107166
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107166
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136294
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1037:Tenm4 UTSW 7 96797481 missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 splice site probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96773987 missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96874213 missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96774146 missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96845808 missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96837314 missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96848017 missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96888814 missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96845926 missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96895985 missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96893014 missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96863533 missense probably benign 0.00
R7692:Tenm4 UTSW 7 96895403 missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96894702 missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96895692 missense probably benign 0.38
R7792:Tenm4 UTSW 7 96774014 missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96873874 missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96906380 missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96852357 missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96874305 missense probably benign 0.44
R8017:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96704041 missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96729346 splice site probably benign
R8061:Tenm4 UTSW 7 96852456 missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96854728 missense probably benign 0.39
R8140:Tenm4 UTSW 7 96895176 missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96895407 missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96867991 missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96772106 critical splice donor site probably null
R8542:Tenm4 UTSW 7 96811932 missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96905941 missense probably benign
R8670:Tenm4 UTSW 7 96905941 missense probably benign
R8683:Tenm4 UTSW 7 96902857 missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96905941 missense probably benign
R8692:Tenm4 UTSW 7 96905941 missense probably benign
R8714:Tenm4 UTSW 7 96905941 missense probably benign
R8716:Tenm4 UTSW 7 96905941 missense probably benign
R8735:Tenm4 UTSW 7 96905941 missense probably benign
R8736:Tenm4 UTSW 7 96905941 missense probably benign
R8737:Tenm4 UTSW 7 96905941 missense probably benign
R8738:Tenm4 UTSW 7 96873840 missense probably damaging 1.00
R8738:Tenm4 UTSW 7 96905941 missense probably benign
R8739:Tenm4 UTSW 7 96905941 missense probably benign
R8776:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96895032 missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96896037 missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96874128 missense probably benign 0.01
R8851:Tenm4 UTSW 7 96852503 missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96702745 splice site probably benign
R8977:Tenm4 UTSW 7 96811970 missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96845854 missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96823918 missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96823873 missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96772027 missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96892919 missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96885439 missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96896145 missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96896160 missense probably benign
R9466:Tenm4 UTSW 7 96550045 missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96823849 missense probably benign
R9626:Tenm4 UTSW 7 96896138 missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96905914 missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96863585 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGTGGCTCTGAATAGAAGG -3'
(R):5'- ATGATGTCAGTGGTCACTCG -3'

Sequencing Primer
(F):5'- GCTCTGAATAGAAGGGTGTGG -3'
(R):5'- GGCAAACTTGACCCCCTTG -3'
Posted On 2016-03-17