Incidental Mutation 'R4880:Dchs1'
ID 375218
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms 3110041P15Rik, C130033F22Rik
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4880 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105752990-105787654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105755730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2535 (D2535V)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: D2535V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: D2535V

signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105758743 missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105758029 missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105758424 missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105755261 missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105758207 missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105757943 missense probably benign
IGL01292:Dchs1 APN 7 105760891 missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105762211 missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105772283 missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105771927 missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105755302 missense probably benign 0.00
IGL01829:Dchs1 APN 7 105755397 missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105759105 missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105757591 missense probably benign 0.00
IGL02012:Dchs1 APN 7 105764297 missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105764887 missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105772569 missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105755188 missense probably benign 0.22
IGL02430:Dchs1 APN 7 105771971 missense probably benign 0.34
IGL02500:Dchs1 APN 7 105755806 missense probably benign
IGL02741:Dchs1 APN 7 105757323 missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105756491 missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105755072 missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105758405 missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105757588 missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105758971 missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105755836 missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105755932 missense probably benign 0.18
R0091:Dchs1 UTSW 7 105766094 splice site probably benign
R0193:Dchs1 UTSW 7 105764983 missense probably benign 0.40
R0395:Dchs1 UTSW 7 105758538 missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105765927 missense probably benign 0.00
R0480:Dchs1 UTSW 7 105771489 missense probably benign 0.14
R0485:Dchs1 UTSW 7 105772727 missense probably benign 0.00
R0566:Dchs1 UTSW 7 105759195 missense probably benign 0.00
R0571:Dchs1 UTSW 7 105771996 missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105758778 missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105764255 missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105763449 missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105772349 missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105764984 missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105757714 missense probably benign
R1241:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105755571 missense probably benign 0.40
R1427:Dchs1 UTSW 7 105766191 missense probably benign 0.06
R1458:Dchs1 UTSW 7 105755244 missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105772071 nonsense probably null
R1524:Dchs1 UTSW 7 105764525 missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105758931 missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105772040 missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105771861 missense probably benign 0.01
R1577:Dchs1 UTSW 7 105765955 missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105762770 missense probably benign 0.24
R1676:Dchs1 UTSW 7 105754921 missense probably benign 0.40
R1794:Dchs1 UTSW 7 105771720 missense probably benign 0.02
R1826:Dchs1 UTSW 7 105757627 missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105764156 missense probably benign 0.00
R1924:Dchs1 UTSW 7 105772280 missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105765902 missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105764201 missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105772398 missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105762548 missense probably benign 0.00
R2007:Dchs1 UTSW 7 105755325 missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105764204 missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105754094 missense probably benign
R2474:Dchs1 UTSW 7 105755074 missense probably benign 0.37
R2474:Dchs1 UTSW 7 105772838 missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105756504 missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105762316 missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105757085 missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105761635 missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105762563 missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105765140 missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105766190 missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105753759 missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105754852 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105754765 missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105758973 missense probably benign
R4588:Dchs1 UTSW 7 105756041 missense probably benign
R4613:Dchs1 UTSW 7 105772724 missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105754355 missense probably benign 0.02
R4696:Dchs1 UTSW 7 105764627 missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4725:Dchs1 UTSW 7 105765552 missense probably damaging 1.00
R4738:Dchs1 UTSW 7 105758673 missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105771620 missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105765926 missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105755253 missense probably damaging 0.98
R4909:Dchs1 UTSW 7 105766255 missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105772177 missense probably benign 0.09
R5109:Dchs1 UTSW 7 105765014 missense probably benign
R5126:Dchs1 UTSW 7 105753517 missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105755658 missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105754602 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105772055 missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105758029 missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105755293 missense probably benign 0.11
R5623:Dchs1 UTSW 7 105772769 missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105772809 missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105755748 missense probably benign 0.01
R5743:Dchs1 UTSW 7 105771596 missense probably benign
R5759:Dchs1 UTSW 7 105764176 missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105773040 missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105772035 missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105759166 missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105755925 missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105754095 missense probably benign 0.08
R6065:Dchs1 UTSW 7 105755421 missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105760925 missense probably benign
R6137:Dchs1 UTSW 7 105765106 missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105764938 missense probably benign 0.05
R6363:Dchs1 UTSW 7 105758472 missense probably benign 0.12
R6466:Dchs1 UTSW 7 105764541 missense probably benign 0.09
R6544:Dchs1 UTSW 7 105758178 missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105758806 missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105762913 missense probably benign 0.17
R6632:Dchs1 UTSW 7 105761878 missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105758793 missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105757003 missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105763503 missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105757021 missense probably benign
R7064:Dchs1 UTSW 7 105763185 missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105761871 missense probably benign 0.04
R7191:Dchs1 UTSW 7 105765439 missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105755131 nonsense probably null
R7380:Dchs1 UTSW 7 105758628 missense probably benign 0.35
R7438:Dchs1 UTSW 7 105754948 missense probably benign 0.30
R7496:Dchs1 UTSW 7 105761859 missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105772373 missense probably benign 0.00
R7604:Dchs1 UTSW 7 105765982 missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105759238 missense probably benign
R7821:Dchs1 UTSW 7 105765145 missense probably benign 0.00
R7834:Dchs1 UTSW 7 105765567 missense probably benign 0.39
R7841:Dchs1 UTSW 7 105762973 missense probably benign
R7913:Dchs1 UTSW 7 105759228 missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105755188 missense probably benign 0.45
R8076:Dchs1 UTSW 7 105755921 missense possibly damaging 0.52
R8076:Dchs1 UTSW 7 105761982 missense probably damaging 1.00
R8087:Dchs1 UTSW 7 105753499 missense probably benign 0.41
R8125:Dchs1 UTSW 7 105764882 missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105762617 missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105765511 missense probably benign 0.22
R8476:Dchs1 UTSW 7 105758808 missense probably benign 0.05
R8497:Dchs1 UTSW 7 105758961 missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105771738 missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105760857 missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105755390 missense probably benign 0.00
R8948:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R8950:Dchs1 UTSW 7 105759005 missense probably benign 0.30
R9029:Dchs1 UTSW 7 105753712 missense probably benign 0.13
R9039:Dchs1 UTSW 7 105756008 missense probably benign 0.11
R9081:Dchs1 UTSW 7 105754429 missense probably benign 0.00
R9134:Dchs1 UTSW 7 105755703 missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105765919 missense probably benign
R9162:Dchs1 UTSW 7 105765525 missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105772907 missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105755626 missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105753913 missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105766195 missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105765774 critical splice donor site probably null
R9392:Dchs1 UTSW 7 105772662 missense probably benign 0.09
R9619:Dchs1 UTSW 7 105764455 missense probably benign 0.07
R9680:Dchs1 UTSW 7 105762418 missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105757984 missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105763475 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105757693 missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105758551 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-03-17