Incidental Mutation 'R4880:Itgb1'
ID375222
Institutional Source Beutler Lab
Gene Symbol Itgb1
Ensembl Gene ENSMUSG00000025809
Gene Nameintegrin beta 1 (fibronectin receptor beta)
SynonymsGm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location128685654-128733200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128716150 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 272 (R272L)
Ref Sequence ENSEMBL: ENSMUSP00000087457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]
Predicted Effect probably damaging
Transcript: ENSMUST00000090006
AA Change: R272L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: R272L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PSI 26 76 3.01e-7 SMART
INB 34 464 2e-298 SMART
VWA 142 372 1.45e0 SMART
low complexity region 568 581 N/A INTRINSIC
Pfam:EGF_2 599 630 8.8e-8 PFAM
Integrin_B_tail 640 728 4.58e-37 SMART
transmembrane domain 729 751 N/A INTRINSIC
Integrin_b_cyt 752 798 3.43e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124826
SMART Domains Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3VI4|D 21 51 2e-16 PDB
Blast:PSI 26 51 1e-11 BLAST
Meta Mutation Damage Score 0.9463 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Itgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Itgb1 APN 8 128713918 splice site probably benign
IGL01407:Itgb1 APN 8 128722834 missense probably benign 0.08
IGL03025:Itgb1 APN 8 128722584 missense possibly damaging 0.96
Drystacked UTSW 8 128732054 missense possibly damaging 0.79
Jumble UTSW 8 128714116 missense probably damaging 1.00
PIT4377001:Itgb1 UTSW 8 128710383 missense probably damaging 1.00
R0136:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0244:Itgb1 UTSW 8 128717685 splice site probably benign
R0483:Itgb1 UTSW 8 128726167 missense possibly damaging 0.79
R0606:Itgb1 UTSW 8 128722372 unclassified probably benign
R0657:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0865:Itgb1 UTSW 8 128710251 critical splice acceptor site probably null
R1052:Itgb1 UTSW 8 128713305 missense probably damaging 1.00
R1429:Itgb1 UTSW 8 128717676 critical splice donor site probably null
R1589:Itgb1 UTSW 8 128705458 missense probably damaging 0.99
R1589:Itgb1 UTSW 8 128705459 missense possibly damaging 0.95
R1614:Itgb1 UTSW 8 128720065 missense probably damaging 1.00
R1672:Itgb1 UTSW 8 128732045 missense probably damaging 1.00
R1723:Itgb1 UTSW 8 128726038 missense probably damaging 0.98
R1865:Itgb1 UTSW 8 128720457 missense probably benign 0.01
R3786:Itgb1 UTSW 8 128713358 missense probably damaging 1.00
R4223:Itgb1 UTSW 8 128714143 missense probably damaging 1.00
R4756:Itgb1 UTSW 8 128717222 missense probably damaging 0.98
R4826:Itgb1 UTSW 8 128720308 missense probably damaging 1.00
R5202:Itgb1 UTSW 8 128720010 missense probably damaging 0.99
R5682:Itgb1 UTSW 8 128727068 splice site probably null
R5935:Itgb1 UTSW 8 128713237 nonsense probably null
R6156:Itgb1 UTSW 8 128732054 missense possibly damaging 0.79
R6160:Itgb1 UTSW 8 128720283 missense possibly damaging 0.95
R6248:Itgb1 UTSW 8 128722421 missense possibly damaging 0.80
R6812:Itgb1 UTSW 8 128705410 splice site probably null
R6869:Itgb1 UTSW 8 128720035 missense probably benign 0.01
R7249:Itgb1 UTSW 8 128720404 missense probably benign 0.28
R7496:Itgb1 UTSW 8 128720305 missense probably benign
R7679:Itgb1 UTSW 8 128720448 missense probably damaging 0.99
R7787:Itgb1 UTSW 8 128727018 missense probably benign 0.32
R7800:Itgb1 UTSW 8 128713237 missense possibly damaging 0.89
R8015:Itgb1 UTSW 8 128722401 missense possibly damaging 0.79
R8687:Itgb1 UTSW 8 128716216 missense probably damaging 1.00
R8709:Itgb1 UTSW 8 128713406 intron probably benign
Z1088:Itgb1 UTSW 8 128713369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGCAACATTAGCCTTGG -3'
(R):5'- GCTTTCCCAGCCATCATCAG -3'

Sequencing Primer
(F):5'- TGGGACAAGAAAGACAATGATACAG -3'
(R):5'- CTCCCACATGCTCAGGATTAC -3'
Posted On2016-03-17