Incidental Mutation 'R4880:Olfr921'
ID375223
Institutional Source Beutler Lab
Gene Symbol Olfr921
Ensembl Gene ENSMUSG00000049926
Gene Nameolfactory receptor 921
SynonymsMOR165-8, GA_x6K02T2PVTD-32478047-32478988
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38773068-38779021 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38775547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 97 (C97*)
Ref Sequence ENSEMBL: ENSMUSP00000150844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000213958] [ENSMUST00000217114]
Predicted Effect probably null
Transcript: ENSMUST00000062124
AA Change: C97*
SMART Domains Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: C97*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-48 PFAM
Pfam:7tm_1 41 290 6.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071681
AA Change: C97*
SMART Domains Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: C97*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-51 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213958
AA Change: C97*
Predicted Effect probably null
Transcript: ENSMUST00000217114
AA Change: C97*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Olfr921
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr921 APN 9 38775812 nonsense probably null
IGL01016:Olfr921 APN 9 38775441 missense probably damaging 0.99
IGL01391:Olfr921 APN 9 38775530 missense probably damaging 1.00
IGL01451:Olfr921 APN 9 38775929 missense probably benign 0.04
IGL02250:Olfr921 APN 9 38775554 missense probably damaging 1.00
R0026:Olfr921 UTSW 9 38775596 missense probably benign 0.01
R0334:Olfr921 UTSW 9 38775239 critical splice acceptor site probably null
R0655:Olfr921 UTSW 9 38775554 nonsense probably null
R1024:Olfr921 UTSW 9 38775335 missense probably damaging 0.97
R3522:Olfr921 UTSW 9 38775720 missense possibly damaging 0.67
R3967:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3968:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3969:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R4761:Olfr921 UTSW 9 38775837 missense probably benign 0.05
R4796:Olfr921 UTSW 9 38775374 missense probably benign 0.15
R5237:Olfr921 UTSW 9 38775956 missense probably damaging 1.00
R5756:Olfr921 UTSW 9 38775258 start codon destroyed probably null 1.00
R6230:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R6487:Olfr921 UTSW 9 38775435 missense probably damaging 1.00
R7514:Olfr921 UTSW 9 38775678 missense probably damaging 1.00
R7573:Olfr921 UTSW 9 38775495 missense probably damaging 1.00
R7755:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R8195:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8196:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8197:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8199:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8211:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8212:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8236:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8239:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8279:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8282:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8283:Olfr921 UTSW 9 38775281 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACCAGCCTGGACTCCAAATG -3'
(R):5'- AGCATGCAACCAGTATGGATCATAG -3'

Sequencing Primer
(F):5'- TGATCACAGTATTCGGTAATTTGAC -3'
(R):5'- GGACATGGCAGTGTTATAC -3'
Posted On2016-03-17