Incidental Mutation 'R4880:Gnptab'
ID375231
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 88432551 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 507 (Q507*)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably null
Transcript: ENSMUST00000020251
AA Change: Q507*
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Q507*

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Myh7 C A 14: 54,978,588 V1323F probably benign Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
R7463:Gnptab UTSW 10 88431389 missense probably damaging 1.00
R7596:Gnptab UTSW 10 88443370 missense probably damaging 0.99
R7654:Gnptab UTSW 10 88445819 missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88379528 missense probably damaging 0.99
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGACAGTGTCCCCTGAAG -3'
(R):5'- ATCGAGTGTCACTTAAAGGGTG -3'

Sequencing Primer
(F):5'- ACATGATGAGCTGAGCGGTCC -3'
(R):5'- GGTGACAACCATAGAGGT -3'
Posted On2016-03-17