Mutagenetix > Incidental Mutations

Incidental Mutation 'R4880:Gnptab'

375231

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

042489-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R4880 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 88432551 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 507 (Q507*)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

probably null
Transcript: ENSMUST00000020251
AA Change: Q507*

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Q507*

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132738

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155306

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	G	9: 92,354,612	E108G	probably damaging	Het
2610021A01Rik	T	C	7: 41,627,105	I744T	possibly damaging	Het
4931409K22Rik	T	C	5: 24,549,752	D340G	probably benign	Het
Adgrb1	T	A	15: 74,587,022	F1324L	possibly damaging	Het
Adm	A	G	7: 110,629,119	H230R	probably benign	Het
Ank2	A	T	3: 127,046,826		probably null	Het
Arih1	A	T	9: 59,436,885	F156L	possibly damaging	Het
Atf6b	A	G	17: 34,654,555	H660R	probably damaging	Het
Bcl9l	C	A	9: 44,508,710	Q1101K	probably benign	Het
Ccdc174	G	A	6: 91,899,591		probably benign	Het
Ccdc65	A	C	15: 98,722,657		probably null	Het
Cela2a	T	C	4: 141,822,287	N59S	probably benign	Het
Cfap157	A	T	2: 32,778,249	V393E	probably damaging	Het
Chd1	T	C	17: 17,374,654	F17S	probably damaging	Het
Cpne3	T	C	4: 19,540,827	I183V	probably benign	Het
Cyp2d11	C	A	15: 82,392,105	V122L	probably benign	Het
Dcaf8	C	A	1: 172,187,489		probably benign	Het
Dchs1	T	A	7: 105,755,730	D2535V	probably benign	Het
Eif4a2	G	T	16: 23,108,900		probably benign	Het
Fzd4	T	A	7: 89,407,901	D385E	probably benign	Het
Galnt13	C	A	2: 55,060,572	Q422K	probably damaging	Het
Gm9745	A	T	13: 8,940,666		probably null	Het
Hoxa7	A	G	6: 52,217,034		probably benign	Het
Htra1	T	A	7: 130,962,083	V228D	probably damaging	Het
Ifi203	T	A	1: 173,929,150		probably benign	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732		probably null	Het
Itga2b	G	T	11: 102,457,722		probably benign	Het
Itgb1	G	T	8: 128,716,150	R272L	probably damaging	Het
Kif9	A	G	9: 110,501,635	E343G	probably damaging	Het
Klhl5	T	C	5: 65,158,901	V97A	probably damaging	Het
Lama5	C	A	2: 180,177,068		probably benign	Het
Lamb2	A	G	9: 108,484,027		probably null	Het
Lrp1b	T	A	2: 41,770,919	Y59F	probably benign	Het
Mmrn1	A	G	6: 60,976,439	E568G	probably benign	Het
Mreg	A	G	1: 72,162,336	Y166H	probably damaging	Het
Myh7	C	A	14: 54,978,588	V1323F	probably benign	Het
Nr1i3	T	A	1: 171,216,382	I91K	probably damaging	Het
Nsfl1c	T	A	2: 151,506,310	D206E	probably damaging	Het
Olfr1294	A	T	2: 111,537,353	L312*	probably null	Het
Olfr181	A	C	16: 58,926,100	L157W	probably damaging	Het
Olfr273	A	T	4: 52,856,411	M34K	probably damaging	Het
Olfr318	G	A	11: 58,720,281	L256F	probably benign	Het
Olfr739	T	C	14: 50,425,301	Y261H	possibly damaging	Het
Olfr921	T	A	9: 38,775,547	C97*	probably null	Het
Pcdhb7	C	T	18: 37,342,231	T140I	probably benign	Het
Pcdhgb5	T	G	18: 37,732,588	S479A	probably benign	Het
Pcsk5	T	A	19: 17,447,690	Y1583F	probably damaging	Het
Pias1	T	C	9: 62,912,798	R296G	probably benign	Het
Polr1e	T	A	4: 45,022,280	C100S	probably damaging	Het
Rpap1	C	A	2: 119,783,865	R17L	probably damaging	Het
Rtn1	C	T	12: 72,217,458	V192I	possibly damaging	Het
Ryr2	G	A	13: 11,752,218	P1262L	probably damaging	Het
Slc4a7	G	T	14: 14,757,342	D396Y	probably damaging	Het
Slc5a8	T	C	10: 88,892,024	Y118H	probably damaging	Het
Slc7a6os	T	A	8: 106,210,615	Q71L	probably benign	Het
Sphkap	A	G	1: 83,288,817	V127A	probably damaging	Het
Srpk1	A	G	17: 28,591,225	S580P	probably damaging	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tchh	A	G	3: 93,443,823	D190G	possibly damaging	Het
Tenm4	T	A	7: 96,905,818		probably null	Het
Tex14	T	A	11: 87,486,295	I155N	possibly damaging	Het
Tm7sf3	A	T	6: 146,609,860	V377E	possibly damaging	Het
Tnfsf9	T	A	17: 57,105,433	M1K	probably null	Het
Tns2	C	T	15: 102,112,039	T780I	probably damaging	Het
Trdn	T	A	10: 33,471,579	D639E	probably benign	Het
Trmt10a	A	G	3: 138,152,211	E173G	possibly damaging	Het
Ttn	G	A	2: 76,818,775	P10984S	possibly damaging	Het
Tubb6	C	T	18: 67,401,316	T95M	possibly damaging	Het
Uroc1	G	T	6: 90,357,537	R577L	probably damaging	Het
Vmn2r86	T	A	10: 130,453,615	D137V	probably benign	Het
Xkr7	T	C	2: 153,054,953	Y576H	probably damaging	Het
Zfp410	A	G	12: 84,337,675	N355D	probably damaging	Het
Zfp59	C	A	7: 27,844,317	D22E	probably damaging	Het
Zfp64	C	T	2: 168,894,377	R460H	probably damaging	Het
Zfp655	T	C	5: 145,244,358	V342A	probably damaging	Het
Zfp990	G	A	4: 145,537,920	G496E	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGACAGTGTCCCCTGAAG -3'
(R):5'- ATCGAGTGTCACTTAAAGGGTG -3'

Sequencing Primer
(F):5'- ACATGATGAGCTGAGCGGTCC -3'
(R):5'- GGTGACAACCATAGAGGT -3'

Posted On

2016-03-17