Incidental Mutation 'R4880:Ryr2'
ID 375242
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 042489-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4880 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 11567988-12121831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11767104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1262 (P1262L)
Ref Sequence ENSEMBL: ENSMUSP00000021750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: P1262L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: P1262L

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170156
AA Change: P1262L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: P1262L

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221609
Meta Mutation Damage Score 0.0882 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,276,529 (GRCm39) I744T possibly damaging Het
Adgrb1 T A 15: 74,458,871 (GRCm39) F1324L possibly damaging Het
Adm A G 7: 110,228,326 (GRCm39) H230R probably benign Het
Ank2 A T 3: 126,840,475 (GRCm39) probably null Het
Arih1 A T 9: 59,344,168 (GRCm39) F156L possibly damaging Het
Atf6b A G 17: 34,873,529 (GRCm39) H660R probably damaging Het
Bcl9l C A 9: 44,420,007 (GRCm39) Q1101K probably benign Het
Ccdc174 G A 6: 91,876,572 (GRCm39) probably benign Het
Ccdc65 A C 15: 98,620,538 (GRCm39) probably null Het
Cela2a T C 4: 141,549,598 (GRCm39) N59S probably benign Het
Cfap157 A T 2: 32,668,261 (GRCm39) V393E probably damaging Het
Chd1 T C 17: 17,594,916 (GRCm39) F17S probably damaging Het
Cpne3 T C 4: 19,540,827 (GRCm39) I183V probably benign Het
Cyp2d11 C A 15: 82,276,306 (GRCm39) V122L probably benign Het
Dcaf8 C A 1: 172,015,056 (GRCm39) probably benign Het
Dchs1 T A 7: 105,404,937 (GRCm39) D2535V probably benign Het
Eif4a2 G T 16: 22,927,650 (GRCm39) probably benign Het
Fzd4 T A 7: 89,057,109 (GRCm39) D385E probably benign Het
Galnt13 C A 2: 54,950,584 (GRCm39) Q422K probably damaging Het
Gnptab C T 10: 88,268,413 (GRCm39) Q507* probably null Het
Hoxa7 A G 6: 52,194,014 (GRCm39) probably benign Het
Htra1 T A 7: 130,563,813 (GRCm39) V228D probably damaging Het
Idi2l A T 13: 8,990,702 (GRCm39) probably null Het
Ifi203 T A 1: 173,756,716 (GRCm39) probably benign Het
Iqca1l T C 5: 24,754,750 (GRCm39) D340G probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Itga2b G T 11: 102,348,548 (GRCm39) probably benign Het
Itgb1 G T 8: 129,442,631 (GRCm39) R272L probably damaging Het
Kif9 A G 9: 110,330,703 (GRCm39) E343G probably damaging Het
Klhl5 T C 5: 65,316,244 (GRCm39) V97A probably damaging Het
Lama5 C A 2: 179,818,861 (GRCm39) probably benign Het
Lamb2 A G 9: 108,361,226 (GRCm39) probably null Het
Lrp1b T A 2: 41,660,931 (GRCm39) Y59F probably benign Het
Mmrn1 A G 6: 60,953,423 (GRCm39) E568G probably benign Het
Mreg A G 1: 72,201,495 (GRCm39) Y166H probably damaging Het
Myh7 C A 14: 55,216,045 (GRCm39) V1323F probably benign Het
Nr1i3 T A 1: 171,043,951 (GRCm39) I91K probably damaging Het
Nsfl1c T A 2: 151,348,230 (GRCm39) D206E probably damaging Het
Or11g24 T C 14: 50,662,758 (GRCm39) Y261H possibly damaging Het
Or13c3 A T 4: 52,856,411 (GRCm39) M34K probably damaging Het
Or2ak5 G A 11: 58,611,107 (GRCm39) L256F probably benign Het
Or4k44 A T 2: 111,367,698 (GRCm39) L312* probably null Het
Or5k17 A C 16: 58,746,463 (GRCm39) L157W probably damaging Het
Or8b54 T A 9: 38,686,843 (GRCm39) C97* probably null Het
Pcdhb7 C T 18: 37,475,284 (GRCm39) T140I probably benign Het
Pcdhgb5 T G 18: 37,865,641 (GRCm39) S479A probably benign Het
Pcsk5 T A 19: 17,425,054 (GRCm39) Y1583F probably damaging Het
Pias1 T C 9: 62,820,080 (GRCm39) R296G probably benign Het
Plscr1l1 A G 9: 92,236,665 (GRCm39) E108G probably damaging Het
Polr1e T A 4: 45,022,280 (GRCm39) C100S probably damaging Het
Rpap1 C A 2: 119,614,346 (GRCm39) R17L probably damaging Het
Rtn1 C T 12: 72,264,232 (GRCm39) V192I possibly damaging Het
Slc4a7 G T 14: 14,757,342 (GRCm38) D396Y probably damaging Het
Slc5a8 T C 10: 88,727,886 (GRCm39) Y118H probably damaging Het
Slc7a6os T A 8: 106,937,247 (GRCm39) Q71L probably benign Het
Sphkap A G 1: 83,266,538 (GRCm39) V127A probably damaging Het
Srpk1 A G 17: 28,810,199 (GRCm39) S580P probably damaging Het
Syne2 A G 12: 76,026,593 (GRCm39) I3474V probably damaging Het
Tchh A G 3: 93,351,130 (GRCm39) D190G possibly damaging Het
Tenm4 T A 7: 96,555,025 (GRCm39) probably null Het
Tex14 T A 11: 87,377,121 (GRCm39) I155N possibly damaging Het
Tm7sf3 A T 6: 146,511,358 (GRCm39) V377E possibly damaging Het
Tnfsf9 T A 17: 57,412,433 (GRCm39) M1K probably null Het
Tns2 C T 15: 102,020,474 (GRCm39) T780I probably damaging Het
Trdn T A 10: 33,347,575 (GRCm39) D639E probably benign Het
Trmt10a A G 3: 137,857,972 (GRCm39) E173G possibly damaging Het
Ttn G A 2: 76,649,119 (GRCm39) P10984S possibly damaging Het
Tubb6 C T 18: 67,534,386 (GRCm39) T95M possibly damaging Het
Uroc1 G T 6: 90,334,519 (GRCm39) R577L probably damaging Het
Vmn2r86 T A 10: 130,289,484 (GRCm39) D137V probably benign Het
Xkr7 T C 2: 152,896,873 (GRCm39) Y576H probably damaging Het
Zfp410 A G 12: 84,384,449 (GRCm39) N355D probably damaging Het
Zfp59 C A 7: 27,543,742 (GRCm39) D22E probably damaging Het
Zfp64 C T 2: 168,736,297 (GRCm39) R460H probably damaging Het
Zfp655 T C 5: 145,181,168 (GRCm39) V342A probably damaging Het
Zfp990 G A 4: 145,264,490 (GRCm39) G496E probably benign Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,848,978 (GRCm39) splice site probably benign
IGL00757:Ryr2 APN 13 11,633,490 (GRCm39) splice site probably null
IGL00838:Ryr2 APN 13 11,583,389 (GRCm39) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,600,364 (GRCm39) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,750,388 (GRCm39) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,718,430 (GRCm39) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,653,371 (GRCm39) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,602,125 (GRCm39) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,571,571 (GRCm39) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,606,238 (GRCm39) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,756,922 (GRCm39) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,814,723 (GRCm39) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,866,090 (GRCm39) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,736,676 (GRCm39) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,736,647 (GRCm39) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,616,644 (GRCm39) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,606,202 (GRCm39) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,609,854 (GRCm39) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,707,563 (GRCm39) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,600,366 (GRCm39) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,616,728 (GRCm39) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,610,311 (GRCm39) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,569,436 (GRCm39) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,611,998 (GRCm39) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,762,450 (GRCm39) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,587,143 (GRCm39) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,807,648 (GRCm39) nonsense probably null
IGL02086:Ryr2 APN 13 11,750,442 (GRCm39) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,774,645 (GRCm39) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,752,759 (GRCm39) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,756,755 (GRCm39) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,745,274 (GRCm39) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,762,544 (GRCm39) splice site probably benign
IGL02369:Ryr2 APN 13 11,634,382 (GRCm39) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,737,607 (GRCm39) splice site probably benign
IGL02400:Ryr2 APN 13 11,620,130 (GRCm39) splice site probably benign
IGL02423:Ryr2 APN 13 11,760,084 (GRCm39) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,760,560 (GRCm39) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,720,585 (GRCm39) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,569,397 (GRCm39) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,620,075 (GRCm39) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,753,206 (GRCm39) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,670,563 (GRCm39) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,610,076 (GRCm39) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,722,679 (GRCm39) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,933,205 (GRCm39) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,606,155 (GRCm39) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,774,721 (GRCm39) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,699,365 (GRCm39) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,658,788 (GRCm39) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,650,468 (GRCm39) splice site probably benign
IGL03152:Ryr2 APN 13 11,868,036 (GRCm39) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,756,909 (GRCm39) nonsense probably null
IGL03180:Ryr2 APN 13 11,583,449 (GRCm39) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,739,273 (GRCm39) splice site probably benign
IGL03390:Ryr2 APN 13 11,787,302 (GRCm39) missense probably benign
IGL03410:Ryr2 APN 13 11,603,033 (GRCm39) missense probably damaging 0.99
Arruda UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
Arruda2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
Arruda3 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
barricuda UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB006:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB016:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,732,027 (GRCm39) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,680,848 (GRCm39) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,776,192 (GRCm39) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,722,682 (GRCm39) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,609,641 (GRCm39) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,570,334 (GRCm39) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,839,265 (GRCm39) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,680,805 (GRCm39) missense probably benign
R0018:Ryr2 UTSW 13 11,610,109 (GRCm39) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,683,924 (GRCm39) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,583,361 (GRCm39) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,724,807 (GRCm39) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,729,434 (GRCm39) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,691,137 (GRCm39) splice site probably benign
R0226:Ryr2 UTSW 13 11,787,442 (GRCm39) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,731,863 (GRCm39) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,683,725 (GRCm39) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,720,570 (GRCm39) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,848,981 (GRCm39) splice site probably benign
R0558:Ryr2 UTSW 13 11,814,747 (GRCm39) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,653,329 (GRCm39) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,746,555 (GRCm39) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,650,445 (GRCm39) missense probably null
R0601:Ryr2 UTSW 13 11,720,519 (GRCm39) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,637,838 (GRCm39) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,739,219 (GRCm39) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,581,771 (GRCm39) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,753,012 (GRCm39) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,684,855 (GRCm39) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,960,867 (GRCm39) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,674,999 (GRCm39) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,897,929 (GRCm39) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,702,765 (GRCm39) splice site probably benign
R1400:Ryr2 UTSW 13 11,609,962 (GRCm39) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,729,389 (GRCm39) splice site probably benign
R1443:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,753,035 (GRCm39) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,741,908 (GRCm39) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,616,727 (GRCm39) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,569,478 (GRCm39) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,569,435 (GRCm39) nonsense probably null
R1551:Ryr2 UTSW 13 11,800,029 (GRCm39) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,774,563 (GRCm39) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,809,449 (GRCm39) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,733,368 (GRCm39) nonsense probably null
R1686:Ryr2 UTSW 13 11,618,665 (GRCm39) splice site probably benign
R1696:Ryr2 UTSW 13 11,746,543 (GRCm39) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,602,328 (GRCm39) splice site probably null
R1728:Ryr2 UTSW 13 11,602,308 (GRCm39) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,805,153 (GRCm39) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,715,257 (GRCm39) nonsense probably null
R1801:Ryr2 UTSW 13 11,610,167 (GRCm39) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,575,472 (GRCm39) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,602,202 (GRCm39) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,784,764 (GRCm39) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,746,586 (GRCm39) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,676,961 (GRCm39) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,753,242 (GRCm39) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,673,844 (GRCm39) nonsense probably null
R1897:Ryr2 UTSW 13 11,765,818 (GRCm39) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,606,222 (GRCm39) missense probably benign
R1909:Ryr2 UTSW 13 11,715,235 (GRCm39) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,571,584 (GRCm39) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,746,609 (GRCm39) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,695,966 (GRCm39) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,600,288 (GRCm39) splice site probably null
R2018:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,610,622 (GRCm39) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,680,764 (GRCm39) splice site probably null
R2088:Ryr2 UTSW 13 11,677,115 (GRCm39) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,727,081 (GRCm39) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,575,493 (GRCm39) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,592,759 (GRCm39) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,720,679 (GRCm39) nonsense probably null
R2207:Ryr2 UTSW 13 11,825,823 (GRCm39) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,677,146 (GRCm39) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,753,102 (GRCm39) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,753,128 (GRCm39) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,606,123 (GRCm39) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,816,734 (GRCm39) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,787,466 (GRCm39) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,603,045 (GRCm39) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,753,095 (GRCm39) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,787,313 (GRCm39) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,933,300 (GRCm39) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,707,568 (GRCm39) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,794,153 (GRCm39) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,602,323 (GRCm39) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,752,759 (GRCm39) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,765,611 (GRCm39) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,664,698 (GRCm39) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,620,119 (GRCm39) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,731,952 (GRCm39) nonsense probably null
R4430:Ryr2 UTSW 13 11,750,413 (GRCm39) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,121,301 (GRCm39) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,764,395 (GRCm39) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,765,571 (GRCm39) splice site probably null
R4668:Ryr2 UTSW 13 11,608,003 (GRCm39) missense probably benign
R4677:Ryr2 UTSW 13 11,721,553 (GRCm39) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,839,255 (GRCm39) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,610,119 (GRCm39) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,707,532 (GRCm39) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,731,884 (GRCm39) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,752,639 (GRCm39) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,671,933 (GRCm39) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,731,983 (GRCm39) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,670,584 (GRCm39) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,760,638 (GRCm39) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,683,706 (GRCm39) missense probably damaging 0.99
R4917:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,724,849 (GRCm39) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,960,831 (GRCm39) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,756,897 (GRCm39) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,799,966 (GRCm39) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,610,192 (GRCm39) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,602,140 (GRCm39) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,650,422 (GRCm39) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,715,240 (GRCm39) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,727,129 (GRCm39) nonsense probably null
R5135:Ryr2 UTSW 13 11,677,016 (GRCm39) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,675,175 (GRCm39) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,767,207 (GRCm39) missense probably benign
R5187:Ryr2 UTSW 13 11,787,338 (GRCm39) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,653,316 (GRCm39) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,787,323 (GRCm39) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,705,249 (GRCm39) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,571,544 (GRCm39) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,720,542 (GRCm39) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,720,587 (GRCm39) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,702,795 (GRCm39) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,723,088 (GRCm39) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,616,691 (GRCm39) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,610,468 (GRCm39) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,774,722 (GRCm39) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,784,848 (GRCm39) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,575,460 (GRCm39) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,599,040 (GRCm39) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,805,218 (GRCm39) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,702,788 (GRCm39) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,675,008 (GRCm39) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,741,839 (GRCm39) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,677,124 (GRCm39) nonsense probably null
R5974:Ryr2 UTSW 13 11,729,397 (GRCm39) splice site probably null
R6104:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,807,575 (GRCm39) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,683,903 (GRCm39) missense probably benign
R6208:Ryr2 UTSW 13 11,910,106 (GRCm39) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,848,964 (GRCm39) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,674,993 (GRCm39) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,776,282 (GRCm39) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,677,269 (GRCm39) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,848,893 (GRCm39) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,683,707 (GRCm39) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,724,951 (GRCm39) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,610,529 (GRCm39) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,753,348 (GRCm39) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,701,852 (GRCm39) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,741,816 (GRCm39) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,844,540 (GRCm39) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,842,445 (GRCm39) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,581,834 (GRCm39) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,816,129 (GRCm39) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,669,266 (GRCm39) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,727,052 (GRCm39) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,809,491 (GRCm39) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,839,286 (GRCm39) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,664,662 (GRCm39) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,684,873 (GRCm39) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,683,697 (GRCm39) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,655,213 (GRCm39) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,825,794 (GRCm39) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,816,063 (GRCm39) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,701,864 (GRCm39) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,774,643 (GRCm39) missense probably benign
R7189:Ryr2 UTSW 13 11,898,009 (GRCm39) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,680,799 (GRCm39) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,612,032 (GRCm39) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,753,080 (GRCm39) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,760,517 (GRCm39) missense probably benign
R7365:Ryr2 UTSW 13 11,655,161 (GRCm39) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,799,997 (GRCm39) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,750,506 (GRCm39) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,571,634 (GRCm39) splice site probably null
R7425:Ryr2 UTSW 13 11,720,530 (GRCm39) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,570,349 (GRCm39) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,767,168 (GRCm39) missense probably benign
R7460:Ryr2 UTSW 13 11,720,596 (GRCm39) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,609,762 (GRCm39) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,653,317 (GRCm39) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,752,871 (GRCm39) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,575,539 (GRCm39) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,776,213 (GRCm39) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,776,201 (GRCm39) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,705,219 (GRCm39) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,745,229 (GRCm39) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,765,897 (GRCm39) missense probably benign
R7797:Ryr2 UTSW 13 11,816,066 (GRCm39) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,842,493 (GRCm39) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,721,509 (GRCm39) nonsense probably null
R7872:Ryr2 UTSW 13 11,610,610 (GRCm39) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,807,634 (GRCm39) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
R7952:Ryr2 UTSW 13 11,661,313 (GRCm39) splice site probably null
R8008:Ryr2 UTSW 13 11,671,980 (GRCm39) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,603,026 (GRCm39) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,960,881 (GRCm39) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,618,584 (GRCm39) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,842,439 (GRCm39) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,610,392 (GRCm39) nonsense probably null
R8351:Ryr2 UTSW 13 11,814,718 (GRCm39) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,683,821 (GRCm39) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,699,364 (GRCm39) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,673,894 (GRCm39) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,592,664 (GRCm39) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,575,479 (GRCm39) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,702,875 (GRCm39) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,701,833 (GRCm39) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,683,855 (GRCm39) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,750,509 (GRCm39) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,572,934 (GRCm39) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,799,990 (GRCm39) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,814,768 (GRCm39) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,609,924 (GRCm39) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,609,672 (GRCm39) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,752,989 (GRCm39) nonsense probably null
R9056:Ryr2 UTSW 13 11,610,817 (GRCm39) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,616,724 (GRCm39) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,618,741 (GRCm39) intron probably benign
R9116:Ryr2 UTSW 13 11,587,185 (GRCm39) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,669,292 (GRCm39) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,900,424 (GRCm39) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,610,772 (GRCm39) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,765,854 (GRCm39) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,721,578 (GRCm39) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,695,973 (GRCm39) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,809,459 (GRCm39) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,787,463 (GRCm39) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,752,680 (GRCm39) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,571,490 (GRCm39) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,602,101 (GRCm39) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,760,104 (GRCm39) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,737,646 (GRCm39) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,701,935 (GRCm39) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,609,785 (GRCm39) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,707,599 (GRCm39) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,718,387 (GRCm39) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,658,689 (GRCm39) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,613,497 (GRCm39) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,809,435 (GRCm39) nonsense probably null
Z1177:Ryr2 UTSW 13 11,765,759 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTTGCATAAAACCCAGCTGCTG -3'
(R):5'- GATTCATCCCTGTGTGTAGCC -3'

Sequencing Primer
(F):5'- CAGCTGCTGGATAAAGTGCCTG -3'
(R):5'- CTCGGGGTGGCACAAGTAG -3'
Posted On 2016-03-17