Mutagenetix > Incidental Mutation

Incidental Mutation 'R4880:Chd1'

375252

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

042489-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4880 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17374654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 17 (F17S)

Ref Sequence

ENSEMBL: ENSMUSP00000156350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024620] [ENSMUST00000232199] [ENSMUST00000232396]

AlphaFold

P40201

Predicted Effect

probably damaging
Transcript: ENSMUST00000024620
AA Change: F17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024620
Gene: ENSMUSG00000116564
AA Change: F17S

Domain	Start	End	E-Value	Type
Pfam:Rio2_N	9	91	9.5e-36	PFAM
Pfam:Kdo	105	193	6.3e-8	PFAM
Pfam:RIO1	108	284	1.7e-57	PFAM
Pfam:APH	194	278	3.2e-8	PFAM
low complexity region	326	340	N/A	INTRINSIC
low complexity region	501	518	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000232199

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232288

Predicted Effect

probably damaging
Transcript: ENSMUST00000232396
AA Change: F17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8721

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

98% (89/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	G	9: 92,354,612	E108G	probably damaging	Het
2610021A01Rik	T	C	7: 41,627,105	I744T	possibly damaging	Het
4931409K22Rik	T	C	5: 24,549,752	D340G	probably benign	Het
Adgrb1	T	A	15: 74,587,022	F1324L	possibly damaging	Het
Adm	A	G	7: 110,629,119	H230R	probably benign	Het
Ank2	A	T	3: 127,046,826		probably null	Het
Arih1	A	T	9: 59,436,885	F156L	possibly damaging	Het
Atf6b	A	G	17: 34,654,555	H660R	probably damaging	Het
Bcl9l	C	A	9: 44,508,710	Q1101K	probably benign	Het
Ccdc174	G	A	6: 91,899,591		probably benign	Het
Ccdc65	A	C	15: 98,722,657		probably null	Het
Cela2a	T	C	4: 141,822,287	N59S	probably benign	Het
Cfap157	A	T	2: 32,778,249	V393E	probably damaging	Het
Cpne3	T	C	4: 19,540,827	I183V	probably benign	Het
Cyp2d11	C	A	15: 82,392,105	V122L	probably benign	Het
Dcaf8	C	A	1: 172,187,489		probably benign	Het
Dchs1	T	A	7: 105,755,730	D2535V	probably benign	Het
Eif4a2	G	T	16: 23,108,900		probably benign	Het
Fzd4	T	A	7: 89,407,901	D385E	probably benign	Het
Galnt13	C	A	2: 55,060,572	Q422K	probably damaging	Het
Gm9745	A	T	13: 8,940,666		probably null	Het
Gnptab	C	T	10: 88,432,551	Q507*	probably null	Het
Hoxa7	A	G	6: 52,217,034		probably benign	Het
Htra1	T	A	7: 130,962,083	V228D	probably damaging	Het
Ifi203	T	A	1: 173,929,150		probably benign	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732	913	probably null	Het
Itga2b	G	T	11: 102,457,722		probably benign	Het
Itgb1	G	T	8: 128,716,150	R272L	probably damaging	Het
Kif9	A	G	9: 110,501,635	E343G	probably damaging	Het
Klhl5	T	C	5: 65,158,901	V97A	probably damaging	Het
Lama5	C	A	2: 180,177,068		probably benign	Het
Lamb2	A	G	9: 108,484,027		probably null	Het
Lrp1b	T	A	2: 41,770,919	Y59F	probably benign	Het
Mmrn1	A	G	6: 60,976,439	E568G	probably benign	Het
Mreg	A	G	1: 72,162,336	Y166H	probably damaging	Het
Myh7	C	A	14: 54,978,588	V1323F	probably benign	Het
Nr1i3	T	A	1: 171,216,382	I91K	probably damaging	Het
Nsfl1c	T	A	2: 151,506,310	D206E	probably damaging	Het
Olfr1294	A	T	2: 111,537,353	L312*	probably null	Het
Olfr181	A	C	16: 58,926,100	L157W	probably damaging	Het
Olfr273	A	T	4: 52,856,411	M34K	probably damaging	Het
Olfr318	G	A	11: 58,720,281	L256F	probably benign	Het
Olfr739	T	C	14: 50,425,301	Y261H	possibly damaging	Het
Olfr921	T	A	9: 38,775,547	C97*	probably null	Het
Pcdhb7	C	T	18: 37,342,231	T140I	probably benign	Het
Pcdhgb5	T	G	18: 37,732,588	S479A	probably benign	Het
Pcsk5	T	A	19: 17,447,690	Y1583F	probably damaging	Het
Pias1	T	C	9: 62,912,798	R296G	probably benign	Het
Polr1e	T	A	4: 45,022,280	C100S	probably damaging	Het
Rpap1	C	A	2: 119,783,865	R17L	probably damaging	Het
Rtn1	C	T	12: 72,217,458	V192I	possibly damaging	Het
Ryr2	G	A	13: 11,752,218	P1262L	probably damaging	Het
Slc4a7	G	T	14: 14,757,342	D396Y	probably damaging	Het
Slc5a8	T	C	10: 88,892,024	Y118H	probably damaging	Het
Slc7a6os	T	A	8: 106,210,615	Q71L	probably benign	Het
Sphkap	A	G	1: 83,288,817	V127A	probably damaging	Het
Srpk1	A	G	17: 28,591,225	S580P	probably damaging	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tchh	A	G	3: 93,443,823	D190G	possibly damaging	Het
Tenm4	T	A	7: 96,905,818		probably null	Het
Tex14	T	A	11: 87,486,295	I155N	possibly damaging	Het
Tm7sf3	A	T	6: 146,609,860	V377E	possibly damaging	Het
Tnfsf9	T	A	17: 57,105,433	M1K	probably null	Het
Tns2	C	T	15: 102,112,039	T780I	probably damaging	Het
Trdn	T	A	10: 33,471,579	D639E	probably benign	Het
Trmt10a	A	G	3: 138,152,211	E173G	possibly damaging	Het
Ttn	G	A	2: 76,818,775	P10984S	possibly damaging	Het
Tubb6	C	T	18: 67,401,316	T95M	possibly damaging	Het
Uroc1	G	T	6: 90,357,537	R577L	probably damaging	Het
Vmn2r86	T	A	10: 130,453,615	D137V	probably benign	Het
Xkr7	T	C	2: 153,054,953	Y576H	probably damaging	Het
Zfp410	A	G	12: 84,337,675	N355D	probably damaging	Het
Zfp59	C	A	7: 27,844,317	D22E	probably damaging	Het
Zfp64	C	T	2: 168,894,377	R460H	probably damaging	Het
Zfp655	T	C	5: 145,244,358	V342A	probably damaging	Het
Zfp990	G	A	4: 145,537,920	G496E	probably benign	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACGTGTTCTTACCTAGCG -3'
(R):5'- AGACGTAAGCACATCTGCAGC -3'

Sequencing Primer
(F):5'- GCACGTGTTCTTACCTAGCGATAAG -3'
(R):5'- GTAAGCACATCTGCAGCAAAAG -3'

Posted On

2016-03-17