Mutagenetix > Incidental Mutations

Incidental Mutation 'R4881:Olfr513'

375278

Institutional Source

Beutler Lab

Gene Symbol

Olfr513

Ensembl Gene

ENSMUSG00000051200

Gene Name

olfactory receptor 513

Synonyms

MOR195-1, GA_x6K02T2PBJ9-11084889-11085818

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R4881 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108750973-108756800 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108755405 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 183 (L183P)

Ref Sequence

ENSEMBL: ENSMUSP00000149440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]

AlphaFold

Q8VFZ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000055146
AA Change: L183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: L183P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	307	2.7e-55	PFAM
Pfam:7TM_GPCR_Srsx	33	304	2.3e-6	PFAM
Pfam:7tm_1	39	289	2.8e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214670
AA Change: L183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,278,249	L1040P	possibly damaging	Het
Acot11	C	A	4: 106,755,305		probably null	Het
Aldoart2	C	A	12: 55,566,114	Q275K	probably damaging	Het
Auts2	T	C	5: 131,472,450	T42A	probably damaging	Het
Bora	C	T	14: 99,061,567	L187F	probably damaging	Het
Cbln4	A	G	2: 172,042,139	S54P	possibly damaging	Het
Celsr3	T	A	9: 108,843,941	L2661Q	probably damaging	Het
Cfap65	T	C	1: 74,907,613	T1313A	probably damaging	Het
Dbndd2	C	A	2: 164,490,305		probably benign	Het
Dennd4a	A	G	9: 64,838,844	D4G	possibly damaging	Het
Dmxl1	T	A	18: 49,957,281		probably benign	Het
Dnah7b	T	C	1: 46,201,318	C1532R	probably damaging	Het
Erbb3	A	T	10: 128,576,947	H591Q	probably benign	Het
Exosc4	T	C	15: 76,329,570	L198P	probably damaging	Het
F2r	A	T	13: 95,618,329	C16S	possibly damaging	Het
Fam129b	C	A	2: 32,922,578	Y446*	probably null	Het
Gtf2h4	A	T	17: 35,670,233	I234N	possibly damaging	Het
Ift27	A	T	15: 78,165,248	V84D	probably damaging	Het
Ints10	C	T	8: 68,810,604	A389V	probably benign	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732	913	probably null	Het
Klrc2	T	A	6: 129,660,508	T17S	possibly damaging	Het
Matr3	T	A	18: 35,572,375	S118T	probably damaging	Het
Mfsd6l	C	T	11: 68,557,922	A533V	probably benign	Het
Msh3	A	G	13: 92,266,041		probably benign	Het
Myo5c	A	G	9: 75,284,152	M1103V	probably benign	Het
Olfr1336	A	T	7: 6,460,754	M82L	probably benign	Het
Olfr1391	T	A	11: 49,328,297	D295E	probably benign	Het
Osbpl3	A	T	6: 50,352,784	D88E	possibly damaging	Het
Pou1f1	C	T	16: 65,531,842	T149I	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Rcor1	A	G	12: 111,097,552	D95G	probably damaging	Het
Rttn	T	C	18: 89,101,685	L1748P	probably damaging	Het
Slco2a1	A	G	9: 103,085,832	K629E	possibly damaging	Het
Smarcc1	A	G	9: 110,135,628		probably benign	Het
Son	A	G	16: 91,675,509	K360E	probably benign	Het
Stab1	A	T	14: 31,143,672	M1753K	probably benign	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tmem63c	A	T	12: 87,086,418	T736S	possibly damaging	Het
Tmpo	G	A	10: 91,162,641	P428L	possibly damaging	Het
Tmprss11a	G	T	5: 86,422,573	Q176K	probably damaging	Het
Trappc4	A	G	9: 44,404,025	S219P	probably damaging	Het
Vmn2r117	G	T	17: 23,477,885	P183T	probably damaging	Het
Vmn2r54	C	T	7: 12,629,671	V432I	probably benign	Het
Vtcn1	G	A	3: 100,892,593	G257R	probably benign	Het
Yipf1	T	A	4: 107,345,091	M217K	possibly damaging	Het
Zfc3h1	T	C	10: 115,400,742	S374P	probably benign	Het
Zfp407	T	C	18: 84,559,703	H1095R	probably benign	Het
Zfp661	A	T	2: 127,578,644	H78Q	probably benign	Het
Zfp957	T	C	14: 79,213,409	T317A	unknown	Het
Zfyve9	T	A	4: 108,727,491		probably null	Het

Other mutations in Olfr513

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02491:Olfr513	APN	7	108755114	missense	probably damaging	1.00
IGL03086:Olfr513	APN	7	108755796	utr 3 prime	probably benign
FR4340:Olfr513	UTSW	7	108754954	small insertion	probably benign
IGL02799:Olfr513	UTSW	7	108755623	missense	probably benign
R0218:Olfr513	UTSW	7	108755574	nonsense	probably null
R1103:Olfr513	UTSW	7	108754883	missense	possibly damaging	0.92
R1251:Olfr513	UTSW	7	108754907	missense	probably damaging	0.99
R1450:Olfr513	UTSW	7	108755512	missense	probably damaging	1.00
R1582:Olfr513	UTSW	7	108755110	missense	probably benign	0.04
R1608:Olfr513	UTSW	7	108755102	missense	probably damaging	0.99
R1726:Olfr513	UTSW	7	108755008	missense	probably benign	0.00
R1880:Olfr513	UTSW	7	108755128	missense	probably damaging	1.00
R1881:Olfr513	UTSW	7	108755128	missense	probably damaging	1.00
R2136:Olfr513	UTSW	7	108755223	missense	possibly damaging	0.58
R2216:Olfr513	UTSW	7	108755612	missense	probably damaging	1.00
R4006:Olfr513	UTSW	7	108755261	missense	probably damaging	1.00
R4603:Olfr513	UTSW	7	108755627	missense	probably damaging	1.00
R5132:Olfr513	UTSW	7	108755270	missense	probably damaging	1.00
R5426:Olfr513	UTSW	7	108755717	missense	possibly damaging	0.94
R5679:Olfr513	UTSW	7	108754996	missense	probably damaging	0.97
R5848:Olfr513	UTSW	7	108755574	nonsense	probably null
R5911:Olfr513	UTSW	7	108755675	missense	probably benign	0.36
R6474:Olfr513	UTSW	7	108755029	missense	probably damaging	1.00
R7016:Olfr513	UTSW	7	108755711	missense	probably damaging	1.00
R7783:Olfr513	UTSW	7	108755569	missense	probably damaging	1.00
R8113:Olfr513	UTSW	7	108755231	missense	probably damaging	1.00
R8385:Olfr513	UTSW	7	108755304	nonsense	probably null
R9429:Olfr513	UTSW	7	108755205	missense	probably damaging	0.98
Z1088:Olfr513	UTSW	7	108755104	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CACAATGGCCTATGATCGTTACATG -3'
(R):5'- ATGGTGACCACAGTGAGGTG -3'

Sequencing Primer
(F):5'- ATGATCGTTACATGGCCATCTG -3'
(R):5'- CACAGTGAGGTGGGAGGCAC -3'

Posted On

2016-03-17