Incidental Mutation 'R4881:Olfr513'
ID 375278
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Name olfactory receptor 513
Synonyms MOR195-1, GA_x6K02T2PBJ9-11084889-11085818
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R4881 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108750973-108756800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108755405 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 183 (L183P)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
AlphaFold Q8VFZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000055146
AA Change: L183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: L183P

Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214670
AA Change: L183P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
R7783:Olfr513 UTSW 7 108755569 missense probably damaging 1.00
R8113:Olfr513 UTSW 7 108755231 missense probably damaging 1.00
R8385:Olfr513 UTSW 7 108755304 nonsense probably null
R9429:Olfr513 UTSW 7 108755205 missense probably damaging 0.98
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-03-17