Incidental Mutation 'R4881:Ints10'
ID375280
Institutional Source Beutler Lab
Gene Symbol Ints10
Ensembl Gene ENSMUSG00000031864
Gene Nameintegrator complex subunit 10
Synonyms4921521J11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location68793929-68831667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68810604 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 389 (A389V)
Ref Sequence ENSEMBL: ENSMUSP00000105870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]
Predicted Effect probably benign
Transcript: ENSMUST00000034328
AA Change: A389V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: A389V

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070713
AA Change: A389V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: A389V

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110241
AA Change: A389V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: A389V

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110242
AA Change: A389V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: A389V

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140309
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Ints10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Ints10 APN 8 68819333 missense probably damaging 1.00
IGL00964:Ints10 APN 8 68811986 missense probably damaging 1.00
IGL02326:Ints10 APN 8 68804833 missense probably damaging 0.99
R0012:Ints10 UTSW 8 68807475 missense probably benign 0.01
R0112:Ints10 UTSW 8 68827302 missense probably damaging 0.99
R1302:Ints10 UTSW 8 68827312 missense probably damaging 1.00
R1462:Ints10 UTSW 8 68807644 splice site probably benign
R1540:Ints10 UTSW 8 68796713 splice site probably benign
R1592:Ints10 UTSW 8 68802903 missense possibly damaging 0.69
R1845:Ints10 UTSW 8 68794671 missense probably damaging 1.00
R2144:Ints10 UTSW 8 68796805 missense probably damaging 1.00
R2323:Ints10 UTSW 8 68819345 missense probably benign 0.09
R3765:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R3910:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3912:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3913:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R4050:Ints10 UTSW 8 68827351 missense probably damaging 1.00
R4151:Ints10 UTSW 8 68794598 splice site probably null
R4607:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4608:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4911:Ints10 UTSW 8 68827312 missense probably damaging 0.98
R5255:Ints10 UTSW 8 68793972 start gained probably benign
R5331:Ints10 UTSW 8 68820820 splice site probably null
R5461:Ints10 UTSW 8 68794041 missense possibly damaging 0.59
R5740:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R5741:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R6128:Ints10 UTSW 8 68822252 critical splice donor site probably null
R6465:Ints10 UTSW 8 68807536 missense probably benign
R6868:Ints10 UTSW 8 68797798 missense probably damaging 1.00
R6983:Ints10 UTSW 8 68794051 missense probably damaging 1.00
R7076:Ints10 UTSW 8 68796751 nonsense probably null
R7216:Ints10 UTSW 8 68822157 missense probably damaging 0.96
R7652:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R8134:Ints10 UTSW 8 68802986 nonsense probably null
R8176:Ints10 UTSW 8 68802951 missense probably damaging 1.00
R8185:Ints10 UTSW 8 68796718 missense possibly damaging 0.51
X0027:Ints10 UTSW 8 68808474 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGTTAATTTAGAAAGGCTGTGCAC -3'
(R):5'- GTCTCCTGACCAAAACTGCATC -3'

Sequencing Primer
(F):5'- TTTAGAAAGGCTGTGCACATGTAG -3'
(R):5'- TCTCCTGACCAAAACTGCATCCTATG -3'
Posted On2016-03-17