Mutagenetix > Incidental Mutations

Incidental Mutation 'R4881:Ints10'

375280

Institutional Source

Beutler Lab

Gene Symbol

Ints10

Ensembl Gene

ENSMUSG00000031864

Gene Name

integrator complex subunit 10

Synonyms

4921521J11Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4881 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68793929-68831667 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68810604 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 389 (A389V)

Ref Sequence

ENSEMBL: ENSMUSP00000105870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]

Predicted Effect

probably benign
Transcript: ENSMUST00000034328
AA Change: A389V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: A389V

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000070713
AA Change: A389V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: A389V

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110241
AA Change: A389V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: A389V

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110242
AA Change: A389V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: A389V

Domain	Start	End	E-Value	Type
low complexity region	132	138	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140309

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,278,249	L1040P	possibly damaging	Het
Acot11	C	A	4: 106,755,305		probably null	Het
Aldoart2	C	A	12: 55,566,114	Q275K	probably damaging	Het
Auts2	T	C	5: 131,472,450	T42A	probably damaging	Het
Bora	C	T	14: 99,061,567	L187F	probably damaging	Het
Cbln4	A	G	2: 172,042,139	S54P	possibly damaging	Het
Celsr3	T	A	9: 108,843,941	L2661Q	probably damaging	Het
Cfap65	T	C	1: 74,907,613	T1313A	probably damaging	Het
Dbndd2	C	A	2: 164,490,305		probably benign	Het
Dennd4a	A	G	9: 64,838,844	D4G	possibly damaging	Het
Dmxl1	T	A	18: 49,957,281		probably benign	Het
Dnah7b	T	C	1: 46,201,318	C1532R	probably damaging	Het
Erbb3	A	T	10: 128,576,947	H591Q	probably benign	Het
Exosc4	T	C	15: 76,329,570	L198P	probably damaging	Het
F2r	A	T	13: 95,618,329	C16S	possibly damaging	Het
Fam129b	C	A	2: 32,922,578	Y446*	probably null	Het
Gtf2h4	A	T	17: 35,670,233	I234N	possibly damaging	Het
Ift27	A	T	15: 78,165,248	V84D	probably damaging	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732		probably null	Het
Klrc2	T	A	6: 129,660,508	T17S	possibly damaging	Het
Matr3	T	A	18: 35,572,375	S118T	probably damaging	Het
Mfsd6l	C	T	11: 68,557,922	A533V	probably benign	Het
Msh3	A	G	13: 92,266,041		probably benign	Het
Myo5c	A	G	9: 75,284,152	M1103V	probably benign	Het
Olfr1336	A	T	7: 6,460,754	M82L	probably benign	Het
Olfr1391	T	A	11: 49,328,297	D295E	probably benign	Het
Olfr513	T	C	7: 108,755,405	L183P	probably damaging	Het
Osbpl3	A	T	6: 50,352,784	D88E	possibly damaging	Het
Pou1f1	C	T	16: 65,531,842	T149I	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Rcor1	A	G	12: 111,097,552	D95G	probably damaging	Het
Rttn	T	C	18: 89,101,685	L1748P	probably damaging	Het
Slco2a1	A	G	9: 103,085,832	K629E	possibly damaging	Het
Smarcc1	A	G	9: 110,135,628		probably benign	Het
Son	A	G	16: 91,675,509	K360E	probably benign	Het
Stab1	A	T	14: 31,143,672	M1753K	probably benign	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tmem63c	A	T	12: 87,086,418	T736S	possibly damaging	Het
Tmpo	G	A	10: 91,162,641	P428L	possibly damaging	Het
Tmprss11a	G	T	5: 86,422,573	Q176K	probably damaging	Het
Trappc4	A	G	9: 44,404,025	S219P	probably damaging	Het
Vmn2r117	G	T	17: 23,477,885	P183T	probably damaging	Het
Vmn2r54	C	T	7: 12,629,671	V432I	probably benign	Het
Vtcn1	G	A	3: 100,892,593	G257R	probably benign	Het
Yipf1	T	A	4: 107,345,091	M217K	possibly damaging	Het
Zfc3h1	T	C	10: 115,400,742	S374P	probably benign	Het
Zfp407	T	C	18: 84,559,703	H1095R	probably benign	Het
Zfp661	A	T	2: 127,578,644	H78Q	probably benign	Het
Zfp957	T	C	14: 79,213,409	T317A	unknown	Het
Zfyve9	T	A	4: 108,727,491		probably null	Het

Other mutations in Ints10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Ints10	APN	8	68819333	missense	probably damaging	1.00
IGL00964:Ints10	APN	8	68811986	missense	probably damaging	1.00
IGL02326:Ints10	APN	8	68804833	missense	probably damaging	0.99
R0012:Ints10	UTSW	8	68807475	missense	probably benign	0.01
R0112:Ints10	UTSW	8	68827302	missense	probably damaging	0.99
R1302:Ints10	UTSW	8	68827312	missense	probably damaging	1.00
R1462:Ints10	UTSW	8	68807644	splice site	probably benign
R1540:Ints10	UTSW	8	68796713	splice site	probably benign
R1592:Ints10	UTSW	8	68802903	missense	possibly damaging	0.69
R1845:Ints10	UTSW	8	68794671	missense	probably damaging	1.00
R2144:Ints10	UTSW	8	68796805	missense	probably damaging	1.00
R2323:Ints10	UTSW	8	68819345	missense	probably benign	0.09
R3765:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R3910:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R3912:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R3913:Ints10	UTSW	8	68813620	missense	probably damaging	0.96
R4050:Ints10	UTSW	8	68827351	missense	probably damaging	1.00
R4151:Ints10	UTSW	8	68794598	splice site	probably null
R4607:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4608:Ints10	UTSW	8	68810619	missense	probably damaging	1.00
R4911:Ints10	UTSW	8	68827312	missense	probably damaging	0.98
R5255:Ints10	UTSW	8	68793972	start gained	probably benign
R5331:Ints10	UTSW	8	68820820	splice site	probably null
R5461:Ints10	UTSW	8	68794041	missense	possibly damaging	0.59
R5740:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R5741:Ints10	UTSW	8	68804922	missense	probably damaging	0.96
R6128:Ints10	UTSW	8	68822252	critical splice donor site	probably null
R6465:Ints10	UTSW	8	68807536	missense	probably benign
R6868:Ints10	UTSW	8	68797798	missense	probably damaging	1.00
R6983:Ints10	UTSW	8	68794051	missense	probably damaging	1.00
R7076:Ints10	UTSW	8	68796751	nonsense	probably null
R7216:Ints10	UTSW	8	68822157	missense	probably damaging	0.96
R7652:Ints10	UTSW	8	68825119	missense	possibly damaging	0.78
R8134:Ints10	UTSW	8	68802986	nonsense	probably null
R8176:Ints10	UTSW	8	68802951	missense	probably damaging	1.00
R8185:Ints10	UTSW	8	68796718	missense	possibly damaging	0.51
X0027:Ints10	UTSW	8	68808474	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTGTTAATTTAGAAAGGCTGTGCAC -3'
(R):5'- GTCTCCTGACCAAAACTGCATC -3'

Sequencing Primer
(F):5'- TTTAGAAAGGCTGTGCACATGTAG -3'
(R):5'- TCTCCTGACCAAAACTGCATCCTATG -3'

Posted On

2016-03-17