Incidental Mutation 'R4881:Dennd4a'
ID 375282
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN/MADD domain containing 4A
Synonyms F730015K02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock # R4881 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 64811340-64919667 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64838844 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 4 (D4G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890] [ENSMUST00000213926]
AlphaFold E9Q8V6
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: D4G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: D4G

internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213437
Predicted Effect probably benign
Transcript: ENSMUST00000213926
AA Change: D4G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215025
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 913 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64906920 missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8397:Dennd4a UTSW 9 64889109 missense probably benign
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64912390 missense probably benign
R9219:Dennd4a UTSW 9 64889094 missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64842624 missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64912692 missense probably benign 0.00
R9485:Dennd4a UTSW 9 64907106 nonsense probably null
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-03-17