Incidental Mutation 'R4881:Dennd4a'
ID 375282
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R4881 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64746126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 4 (D4G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890] [ENSMUST00000213926]
AlphaFold E9Q8V6
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: D4G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: D4G

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213437
Predicted Effect probably benign
Transcript: ENSMUST00000213926
AA Change: D4G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215025
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,877,472 (GRCm39) L1040P possibly damaging Het
Acot11 C A 4: 106,612,502 (GRCm39) probably null Het
Aldoart2 C A 12: 55,612,899 (GRCm39) Q275K probably damaging Het
Auts2 T C 5: 131,501,288 (GRCm39) T42A probably damaging Het
Bora C T 14: 99,299,003 (GRCm39) L187F probably damaging Het
Cbln4 A G 2: 171,884,059 (GRCm39) S54P possibly damaging Het
Celsr3 T A 9: 108,721,140 (GRCm39) L2661Q probably damaging Het
Cfap65 T C 1: 74,946,772 (GRCm39) T1313A probably damaging Het
Dbndd2 C A 2: 164,332,225 (GRCm39) probably benign Het
Dmxl1 T A 18: 50,090,348 (GRCm39) probably benign Het
Dnah7b T C 1: 46,240,478 (GRCm39) C1532R probably damaging Het
Erbb3 A T 10: 128,412,816 (GRCm39) H591Q probably benign Het
Exosc4 T C 15: 76,213,770 (GRCm39) L198P probably damaging Het
F2r A T 13: 95,754,837 (GRCm39) C16S possibly damaging Het
Gtf2h4 A T 17: 35,981,125 (GRCm39) I234N possibly damaging Het
Ift27 A T 15: 78,049,448 (GRCm39) V84D probably damaging Het
Ints10 C T 8: 69,263,256 (GRCm39) A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Klrc2 T A 6: 129,637,471 (GRCm39) T17S possibly damaging Het
Matr3 T A 18: 35,705,428 (GRCm39) S118T probably damaging Het
Mfsd6l C T 11: 68,448,748 (GRCm39) A533V probably benign Het
Msh3 A G 13: 92,402,549 (GRCm39) probably benign Het
Myo5c A G 9: 75,191,434 (GRCm39) M1103V probably benign Het
Niban2 C A 2: 32,812,590 (GRCm39) Y446* probably null Het
Or2y1e T A 11: 49,219,124 (GRCm39) D295E probably benign Het
Or5e1 T C 7: 108,354,612 (GRCm39) L183P probably damaging Het
Or6z3 A T 7: 6,463,753 (GRCm39) M82L probably benign Het
Osbpl3 A T 6: 50,329,764 (GRCm39) D88E possibly damaging Het
Pou1f1 C T 16: 65,328,728 (GRCm39) T149I probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Rcor1 A G 12: 111,063,986 (GRCm39) D95G probably damaging Het
Rttn T C 18: 89,119,809 (GRCm39) L1748P probably damaging Het
Slco2a1 A G 9: 102,963,031 (GRCm39) K629E possibly damaging Het
Smarcc1 A G 9: 109,964,696 (GRCm39) probably benign Het
Son A G 16: 91,472,397 (GRCm39) K360E probably benign Het
Stab1 A T 14: 30,865,629 (GRCm39) M1753K probably benign Het
Syne2 A G 12: 76,026,593 (GRCm39) I3474V probably damaging Het
Tmem63c A T 12: 87,133,192 (GRCm39) T736S possibly damaging Het
Tmpo G A 10: 90,998,503 (GRCm39) P428L possibly damaging Het
Tmprss11a G T 5: 86,570,432 (GRCm39) Q176K probably damaging Het
Trappc4 A G 9: 44,315,322 (GRCm39) S219P probably damaging Het
Vmn2r117 G T 17: 23,696,859 (GRCm39) P183T probably damaging Het
Vmn2r54 C T 7: 12,363,598 (GRCm39) V432I probably benign Het
Vtcn1 G A 3: 100,799,909 (GRCm39) G257R probably benign Het
Yipf1 T A 4: 107,202,288 (GRCm39) M217K possibly damaging Het
Zfc3h1 T C 10: 115,236,647 (GRCm39) S374P probably benign Het
Zfp407 T C 18: 84,577,828 (GRCm39) H1095R probably benign Het
Zfp661 A T 2: 127,420,564 (GRCm39) H78Q probably benign Het
Zfp957 T C 14: 79,450,849 (GRCm39) T317A unknown Het
Zfyve9 T A 4: 108,584,688 (GRCm39) probably null Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,819,669 (GRCm39) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGCTATGGGAATTTCCACTAC -3'
(R):5'- ACATAATCCCGTGGCACCTC -3'

Sequencing Primer
(F):5'- TGGGAATTTCCACTACATTTTAAGG -3'
(R):5'- TGGCACCTCCTCCCCAAG -3'
Posted On 2016-03-17