Incidental Mutation 'R4881:Slco2a1'
ID375285
Institutional Source Beutler Lab
Gene Symbol Slco2a1
Ensembl Gene ENSMUSG00000032548
Gene Namesolute carrier organic anion transporter family, member 2a1
SynonymsPgt, mPgt, 2310021C19Rik, Slc21a2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102988712-103096002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103085832 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 629 (K629E)
Ref Sequence ENSEMBL: ENSMUSP00000035148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035148
AA Change: K629E

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: K629E

DomainStartEndE-ValueType
Pfam:MFS_1 39 428 3.5e-22 PFAM
KAZAL 446 493 2.78e-2 SMART
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188664
SMART Domains Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548

DomainStartEndE-ValueType
Pfam:OATP 31 381 4.8e-135 PFAM
Pfam:MFS_1 39 413 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216778
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Slco2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slco2a1 APN 9 103079441 splice site probably benign
IGL01481:Slco2a1 APN 9 103070251 missense probably damaging 1.00
IGL01647:Slco2a1 APN 9 103070296 missense possibly damaging 0.57
IGL01885:Slco2a1 APN 9 103074430 missense probably damaging 1.00
IGL02150:Slco2a1 APN 9 103084818 missense probably damaging 1.00
IGL02508:Slco2a1 APN 9 103074416 missense probably benign
IGL02578:Slco2a1 APN 9 103046758 missense probably damaging 1.00
IGL02622:Slco2a1 APN 9 103076929 nonsense probably null
IGL02898:Slco2a1 APN 9 103079606 missense probably damaging 1.00
IGL03101:Slco2a1 APN 9 103077006 missense possibly damaging 0.69
PIT4431001:Slco2a1 UTSW 9 103050268 missense probably damaging 1.00
R0410:Slco2a1 UTSW 9 103073314 critical splice donor site probably null
R0831:Slco2a1 UTSW 9 103082334 missense probably damaging 0.99
R0885:Slco2a1 UTSW 9 103082383 missense probably damaging 0.98
R1975:Slco2a1 UTSW 9 103079454 nonsense probably null
R2095:Slco2a1 UTSW 9 103076968 missense probably benign 0.22
R4072:Slco2a1 UTSW 9 103068002 missense probably damaging 1.00
R4105:Slco2a1 UTSW 9 103067876 missense probably benign 0.01
R4105:Slco2a1 UTSW 9 103073250 missense probably damaging 1.00
R4804:Slco2a1 UTSW 9 103073184 missense probably damaging 1.00
R5073:Slco2a1 UTSW 9 103046726 missense probably damaging 1.00
R5124:Slco2a1 UTSW 9 103050166 missense probably damaging 1.00
R5147:Slco2a1 UTSW 9 103050269 missense probably damaging 1.00
R5317:Slco2a1 UTSW 9 103079579 missense probably benign 0.01
R5363:Slco2a1 UTSW 9 103070263 missense probably damaging 0.99
R5381:Slco2a1 UTSW 9 103068014 missense probably damaging 1.00
R5732:Slco2a1 UTSW 9 103050256 missense probably damaging 1.00
R5736:Slco2a1 UTSW 9 103067830 missense probably benign 0.00
R5924:Slco2a1 UTSW 9 103046699 nonsense probably null
R5945:Slco2a1 UTSW 9 103046790 missense probably damaging 1.00
R6293:Slco2a1 UTSW 9 103050147 missense probably benign 0.30
R6386:Slco2a1 UTSW 9 103076988 missense probably benign
R6622:Slco2a1 UTSW 9 103074505 missense possibly damaging 0.84
R7325:Slco2a1 UTSW 9 103085749 splice site probably null
R7484:Slco2a1 UTSW 9 103067986 missense probably damaging 1.00
Z1088:Slco2a1 UTSW 9 103079527 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGCTCGTCACCTGAGTAAC -3'
(R):5'- ACCATGCGGGAGACTTTAGG -3'

Sequencing Primer
(F):5'- GTAACGATCTTCACAGCTTCTAGTG -3'
(R):5'- CAAGGGGTGAGTGAACTAACTCTCTC -3'
Posted On2016-03-17