Incidental Mutation 'R4881:Msh3'
ID375296
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 92266041 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191304
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTTGCTTCAAGACTATAGCTGG -3'
(R):5'- TAAACTGAAGCCTACTGAGGATC -3'

Sequencing Primer
(F):5'- CAAGACTATAGCTGGTACTGGTC -3'
(R):5'- GGATCAGAATTCTTAAGATGCACG -3'
Posted On2016-03-17