Mutagenetix > Incidental Mutation

Incidental Mutation 'R4881:Vmn2r117'

375307

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R4881 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 23477885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 183 (P183T)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: P183T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: P183T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,278,249	L1040P	possibly damaging	Het
Acot11	C	A	4: 106,755,305		probably null	Het
Aldoart2	C	A	12: 55,566,114	Q275K	probably damaging	Het
Auts2	T	C	5: 131,472,450	T42A	probably damaging	Het
Bora	C	T	14: 99,061,567	L187F	probably damaging	Het
Cbln4	A	G	2: 172,042,139	S54P	possibly damaging	Het
Celsr3	T	A	9: 108,843,941	L2661Q	probably damaging	Het
Cfap65	T	C	1: 74,907,613	T1313A	probably damaging	Het
Dbndd2	C	A	2: 164,490,305		probably benign	Het
Dennd4a	A	G	9: 64,838,844	D4G	possibly damaging	Het
Dmxl1	T	A	18: 49,957,281		probably benign	Het
Dnah7b	T	C	1: 46,201,318	C1532R	probably damaging	Het
Erbb3	A	T	10: 128,576,947	H591Q	probably benign	Het
Exosc4	T	C	15: 76,329,570	L198P	probably damaging	Het
F2r	A	T	13: 95,618,329	C16S	possibly damaging	Het
Fam129b	C	A	2: 32,922,578	Y446*	probably null	Het
Gtf2h4	A	T	17: 35,670,233	I234N	possibly damaging	Het
Ift27	A	T	15: 78,165,248	V84D	probably damaging	Het
Ints10	C	T	8: 68,810,604	A389V	probably benign	Het
Irs1	TGGGGTGGACATCGAACTGAAGGAG	TG	1: 82,287,732	913	probably null	Het
Klrc2	T	A	6: 129,660,508	T17S	possibly damaging	Het
Matr3	T	A	18: 35,572,375	S118T	probably damaging	Het
Mfsd6l	C	T	11: 68,557,922	A533V	probably benign	Het
Msh3	A	G	13: 92,266,041		probably benign	Het
Myo5c	A	G	9: 75,284,152	M1103V	probably benign	Het
Olfr1336	A	T	7: 6,460,754	M82L	probably benign	Het
Olfr1391	T	A	11: 49,328,297	D295E	probably benign	Het
Olfr513	T	C	7: 108,755,405	L183P	probably damaging	Het
Osbpl3	A	T	6: 50,352,784	D88E	possibly damaging	Het
Pou1f1	C	T	16: 65,531,842	T149I	probably damaging	Het
Ppp1r12b	G	T	1: 134,955,733	A17E	probably benign	Het
Pstpip2	T	A	18: 77,874,332	Y267*	probably null	Het
Rcor1	A	G	12: 111,097,552	D95G	probably damaging	Het
Rttn	T	C	18: 89,101,685	L1748P	probably damaging	Het
Slco2a1	A	G	9: 103,085,832	K629E	possibly damaging	Het
Smarcc1	A	G	9: 110,135,628		probably benign	Het
Son	A	G	16: 91,675,509	K360E	probably benign	Het
Stab1	A	T	14: 31,143,672	M1753K	probably benign	Het
Syne2	A	G	12: 75,979,819	I3474V	probably damaging	Het
Tmem63c	A	T	12: 87,086,418	T736S	possibly damaging	Het
Tmpo	G	A	10: 91,162,641	P428L	possibly damaging	Het
Tmprss11a	G	T	5: 86,422,573	Q176K	probably damaging	Het
Trappc4	A	G	9: 44,404,025	S219P	probably damaging	Het
Vmn2r54	C	T	7: 12,629,671	V432I	probably benign	Het
Vtcn1	G	A	3: 100,892,593	G257R	probably benign	Het
Yipf1	T	A	4: 107,345,091	M217K	possibly damaging	Het
Zfc3h1	T	C	10: 115,400,742	S374P	probably benign	Het
Zfp407	T	C	18: 84,559,703	H1095R	probably benign	Het
Zfp661	A	T	2: 127,578,644	H78Q	probably benign	Het
Zfp957	T	C	14: 79,213,409	T317A	unknown	Het
Zfyve9	T	A	4: 108,727,491		probably null	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCATGTTGACAAAGGCAAAGC -3'
(R):5'- GGGTACTATCACAGACTTGATTGG -3'

Sequencing Primer
(F):5'- TGTTGACAAAGGCAAAGCAGACTG -3'
(R):5'- ACTATCACAGACTTGATTGGTTTCTC -3'

Posted On

2016-03-17