Mutagenetix > Incidental Mutation

Incidental Mutation 'R4882:Axdnd1'

375314

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

MMRRC Submission

042490-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R4882 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 156395559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000178036] [ENSMUST00000213088] [ENSMUST00000213088] [ENSMUST00000213088] [ENSMUST00000213088]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000027895

Predicted Effect

probably null
Transcript: ENSMUST00000177824

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000177824

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177858

Predicted Effect

probably null
Transcript: ENSMUST00000178036

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000178036

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000180173

Predicted Effect

probably null
Transcript: ENSMUST00000180173

Predicted Effect

probably null
Transcript: ENSMUST00000180173

Predicted Effect

probably null
Transcript: ENSMUST00000180173

Predicted Effect

probably null
Transcript: ENSMUST00000213088

Predicted Effect

probably null
Transcript: ENSMUST00000213088

Predicted Effect

probably null
Transcript: ENSMUST00000213088

Predicted Effect

probably null
Transcript: ENSMUST00000213088

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap3	A	G	4: 155,905,655	D764G	probably damaging	Het
Adgrg6	T	A	10: 14,434,337	I775F	possibly damaging	Het
Ahnak	T	A	19: 9,005,897	M1515K	probably damaging	Het
Aqp4	A	G	18: 15,398,254	V150A	possibly damaging	Het
Bap1	C	T	14: 31,251,721		probably benign	Het
BB014433	A	G	8: 15,042,016	V279A	probably benign	Het
Cacng8	T	C	7: 3,412,153	Y151H	probably damaging	Het
Caskin1	T	C	17: 24,504,415	S726P	probably damaging	Het
Cd200	T	C	16: 45,397,017	T104A	probably benign	Het
Cdk12	C	T	11: 98,210,446	R377C	unknown	Het
Ceacam13	A	G	7: 18,013,072	H150R	probably benign	Het
Cebpzos	T	C	17: 78,919,791	Y65H	probably benign	Het
Cgnl1	T	A	9: 71,717,401	M630L	probably benign	Het
Dopey2	G	T	16: 93,752,914	R247L	possibly damaging	Het
Dqx1	A	G	6: 83,066,088		probably null	Het
Etaa1	T	C	11: 17,946,174	S648G	probably benign	Het
Flnb	A	G	14: 7,929,936	D2022G	possibly damaging	Het
Gpr158	T	A	2: 21,825,248	N701K	probably damaging	Het
H2-Eb2	C	T	17: 34,334,256	H139Y	probably benign	Het
Hbb-bh2	A	T	7: 103,839,248	V114E	probably damaging	Het
Ifna9	T	A	4: 88,592,303	Q28L	probably benign	Het
Inca1	T	C	11: 70,688,740	T188A	probably benign	Het
Irf9	G	T	14: 55,609,039		probably benign	Het
Kdm1b	T	A	13: 47,060,893	H238Q	probably benign	Het
Lpin1	G	C	12: 16,538,536	F851L	probably damaging	Het
Map3k9	C	T	12: 81,724,162	R884Q	probably damaging	Het
Mcm3ap	C	T	10: 76,484,661	Q818*	probably null	Het
Mcm7	A	T	5: 138,165,911		probably null	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Nppa	G	T	4: 148,001,087	M50I	probably benign	Het
Opcml	G	A	9: 28,901,590	E193K	probably damaging	Het
Phf14	T	A	6: 11,988,757	N665K	possibly damaging	Het
Plekhh3	G	A	11: 101,165,183	A47V	probably damaging	Het
Plekhh3	T	A	11: 101,167,938	E156V	probably null	Het
Prpf19	T	C	19: 10,898,959		probably benign	Het
Rev3l	T	A	10: 39,821,460	V651E	possibly damaging	Het
Sgpl1	T	C	10: 61,112,265	N171S	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slx4	T	C	16: 3,980,996		probably null	Het
Smchd1	T	A	17: 71,358,239		probably benign	Het
Snca	A	G	6: 60,815,735	V63A	probably benign	Het
Taok3	A	T	5: 117,252,630	Q92L	probably damaging	Het
Uhrf1	T	C	17: 56,309,401	V73A	probably damaging	Het
Usp38	G	A	8: 80,981,977	Q991*	probably null	Het
Vmn2r96	T	A	17: 18,597,604	V673E	probably damaging	Het
Zan	A	G	5: 137,438,448	Y2048H	unknown	Het
Zfp759	T	A	13: 67,139,290	Y302N	probably damaging	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1493:Axdnd1	UTSW	1	156346701	missense	probably benign	0.03
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4969:Axdnd1	UTSW	1	156395505	missense	possibly damaging	0.95
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5792:Axdnd1	UTSW	1	156341889	missense	probably damaging	0.99
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7115:Axdnd1	UTSW	1	156380876	missense
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8348:Axdnd1	UTSW	1	156418284	missense	probably benign	0.02
R8971:Axdnd1	UTSW	1	156391946	missense
R9207:Axdnd1	UTSW	1	156388046	missense
R9294:Axdnd1	UTSW	1	156420347	nonsense	probably null
R9741:Axdnd1	UTSW	1	156341815	missense	probably benign	0.18
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTTTTGACATGGGGAAC -3'
(R):5'- CTGGTAGGTACAATTCAGGAGCC -3'

Sequencing Primer
(F):5'- GGAACCTGGAACATTCCAT -3'
(R):5'- TGAACTCTGGACCTTCGGAAG -3'

Posted On

2016-03-17