Incidental Mutation 'R4882:Gpr158'
ID 375315
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene Name G protein-coupled receptor 158
Synonyms 5330427M13Rik
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4882 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 21367542-21830547 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21825248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 701 (N701K)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
AlphaFold Q8C419
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: N701K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: N701K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
R8311:Gpr158 UTSW 2 21368890 missense probably benign 0.00
R8754:Gpr158 UTSW 2 21576882 missense probably benign 0.00
R8782:Gpr158 UTSW 2 21399338 missense probably damaging 1.00
R8792:Gpr158 UTSW 2 21553326 missense probably damaging 1.00
R8842:Gpr158 UTSW 2 21576940 missense possibly damaging 0.88
R9009:Gpr158 UTSW 2 21576949 missense probably damaging 1.00
R9102:Gpr158 UTSW 2 21825267 missense probably damaging 1.00
R9150:Gpr158 UTSW 2 21826440 missense probably benign 0.17
R9254:Gpr158 UTSW 2 21368231 start gained probably benign
R9317:Gpr158 UTSW 2 21827226 missense probably benign
R9379:Gpr158 UTSW 2 21368231 start gained probably benign
R9428:Gpr158 UTSW 2 21783161 missense probably benign
R9497:Gpr158 UTSW 2 21827014 missense probably benign 0.00
R9667:Gpr158 UTSW 2 21825243 missense probably damaging 0.99
R9681:Gpr158 UTSW 2 21826504 missense probably damaging 0.99
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AACCTTAGAAAATGCTGCACTG -3'
(R):5'- TTGAGACAGTTTTGTGAAGCAC -3'

Sequencing Primer
(F):5'- AATGCTGCACTGTCTAGCAATGG -3'
(R):5'- GTGGTTCTTTCAGTCTCTCACAG -3'
Posted On 2016-03-17