Incidental Mutation 'R4882:Etaa1'
ID375340
Institutional Source Beutler Lab
Gene Symbol Etaa1
Ensembl Gene ENSMUSG00000016984
Gene NameEwing tumor-associated antigen 1
Synonyms5730466H23Rik
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4882 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location17938756-17953875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17946174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 648 (S648G)
Ref Sequence ENSEMBL: ENSMUSP00000075957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076661]
Predicted Effect probably benign
Transcript: ENSMUST00000076661
AA Change: S648G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075957
Gene: ENSMUSG00000016984
AA Change: S648G

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
Pfam:ETAA1 79 865 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Etaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Etaa1 APN 11 17947825 nonsense probably null
IGL00555:Etaa1 APN 11 17947535 missense probably damaging 1.00
IGL01098:Etaa1 APN 11 17946059 missense probably damaging 0.99
IGL01100:Etaa1 APN 11 17952576 critical splice donor site probably null
IGL01312:Etaa1 APN 11 17945909 missense probably damaging 1.00
IGL01391:Etaa1 APN 11 17946005 missense probably damaging 1.00
IGL01607:Etaa1 APN 11 17953637 missense probably benign 0.00
IGL02066:Etaa1 APN 11 17946687 missense probably benign
R0401:Etaa1 UTSW 11 17947514 missense probably damaging 1.00
R0413:Etaa1 UTSW 11 17946350 nonsense probably null
R0790:Etaa1 UTSW 11 17946051 missense probably benign 0.00
R1442:Etaa1 UTSW 11 17947201 missense probably benign 0.19
R1447:Etaa1 UTSW 11 17946625 missense possibly damaging 0.92
R1647:Etaa1 UTSW 11 17946492 missense probably damaging 0.99
R1945:Etaa1 UTSW 11 17947233 missense probably damaging 0.96
R1996:Etaa1 UTSW 11 17952671 missense probably damaging 1.00
R2211:Etaa1 UTSW 11 17952686 nonsense probably null
R2338:Etaa1 UTSW 11 17945605 critical splice donor site probably null
R3027:Etaa1 UTSW 11 17947886 missense probably damaging 1.00
R3546:Etaa1 UTSW 11 17953823 start gained probably benign
R4118:Etaa1 UTSW 11 17946180 missense probably benign 0.18
R4156:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
R4657:Etaa1 UTSW 11 17946964 missense possibly damaging 0.81
R4914:Etaa1 UTSW 11 17946532 missense probably benign 0.05
R4978:Etaa1 UTSW 11 17946581 missense probably damaging 0.99
R5202:Etaa1 UTSW 11 17947853 missense probably damaging 1.00
R5384:Etaa1 UTSW 11 17947539 missense probably damaging 1.00
R5584:Etaa1 UTSW 11 17947406 missense possibly damaging 0.72
R6303:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6304:Etaa1 UTSW 11 17947505 missense probably damaging 1.00
R6351:Etaa1 UTSW 11 17947188 missense possibly damaging 0.95
R6391:Etaa1 UTSW 11 17946833 missense probably benign 0.04
R6685:Etaa1 UTSW 11 17953582 missense probably benign 0.40
R6705:Etaa1 UTSW 11 17945639 missense probably benign 0.02
R6807:Etaa1 UTSW 11 17952680 missense probably benign
R6863:Etaa1 UTSW 11 17953794 start codon destroyed probably benign 0.01
R6985:Etaa1 UTSW 11 17946108 missense probably damaging 0.99
R7129:Etaa1 UTSW 11 17940339 missense possibly damaging 0.92
R7429:Etaa1 UTSW 11 17940281 missense probably damaging 1.00
Z1088:Etaa1 UTSW 11 17946465 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCACTTGTACTGGTCCACGC -3'
(R):5'- AGTGAAATGGTTGAAGCATGCC -3'

Sequencing Primer
(F):5'- GTACTGGTCCACGCTTATTATCAC -3'
(R):5'- ATGCCATCGGTTAGAGGCTAC -3'
Posted On2016-03-17