Incidental Mutation 'R4882:Bap1'
ID 375350
Institutional Source Beutler Lab
Gene Symbol Bap1
Ensembl Gene ENSMUSG00000021901
Gene Name Brca1 associated protein 1
Synonyms 2300006C11Rik
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4882 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 31251450-31259944 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 31251721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000022459] [ENSMUST00000187156] [ENSMUST00000188453] [ENSMUST00000226310] [ENSMUST00000226565] [ENSMUST00000228437] [ENSMUST00000228930]
AlphaFold Q99PU7
Predicted Effect probably benign
Transcript: ENSMUST00000022458
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022459
SMART Domains Protein: ENSMUSP00000022459
Gene: ENSMUSG00000021902

DomainStartEndE-ValueType
PHD 97 145 8.45e-3 SMART
RING 160 207 7.46e-1 SMART
RING 250 300 4.87e0 SMART
PHD 252 301 1.16e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185987
Predicted Effect probably benign
Transcript: ENSMUST00000187156
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188453
SMART Domains Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 4 137 3.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190788
Predicted Effect probably benign
Transcript: ENSMUST00000226310
Predicted Effect probably benign
Transcript: ENSMUST00000226565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228140
Predicted Effect probably benign
Transcript: ENSMUST00000228437
Predicted Effect probably benign
Transcript: ENSMUST00000228930
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Bap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Bap1 APN 14 31253569 missense probably damaging 0.97
IGL02110:Bap1 APN 14 31257414 missense probably damaging 0.97
IGL02740:Bap1 APN 14 31256772 missense possibly damaging 0.94
IGL02937:Bap1 APN 14 31258327 missense probably benign 0.07
R0138:Bap1 UTSW 14 31256724 missense probably damaging 1.00
R1221:Bap1 UTSW 14 31257651 missense probably damaging 1.00
R2131:Bap1 UTSW 14 31258331 nonsense probably null
R2204:Bap1 UTSW 14 31256701 missense probably benign 0.10
R3781:Bap1 UTSW 14 31257618 missense possibly damaging 0.71
R4897:Bap1 UTSW 14 31258445 unclassified probably benign
R5249:Bap1 UTSW 14 31257286 unclassified probably benign
R6548:Bap1 UTSW 14 31256225 missense probably benign 0.01
R6990:Bap1 UTSW 14 31255651 missense probably benign
R7203:Bap1 UTSW 14 31254169 missense probably damaging 1.00
R7212:Bap1 UTSW 14 31251623 missense probably damaging 0.99
R7414:Bap1 UTSW 14 31253615 missense probably benign 0.05
R7956:Bap1 UTSW 14 31255568 missense probably benign 0.11
R8062:Bap1 UTSW 14 31257508 missense probably benign 0.38
R8070:Bap1 UTSW 14 31256686 missense probably damaging 1.00
R8875:Bap1 UTSW 14 31253565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGTCGTGTGATGATGAC -3'
(R):5'- TTTGACACCTACGATCAGGAAAG -3'

Sequencing Primer
(F):5'- CTGTGCGGGGCTGAGAAG -3'
(R):5'- CCTACGATCAGGAAAGGAGAGGTC -3'
Posted On 2016-03-17