Incidental Mutation 'R4882:Dopey2'
ID375355
Institutional Source Beutler Lab
Gene Symbol Dopey2
Ensembl Gene ENSMUSG00000022946
Gene Namedopey family member 2
Synonyms0610038M01Rik, 2610510B01Rik
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4882 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location93711904-93810590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93752914 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 247 (R247L)
Ref Sequence ENSEMBL: ENSMUSP00000154771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045004] [ENSMUST00000227156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045004
AA Change: R365L

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044437
Gene: ENSMUSG00000022946
AA Change: R365L

DomainStartEndE-ValueType
Pfam:Dopey_N 11 308 3.9e-104 PFAM
low complexity region 651 666 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 747 759 N/A INTRINSIC
low complexity region 1186 1199 N/A INTRINSIC
low complexity region 1436 1451 N/A INTRINSIC
low complexity region 1893 1908 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000227156
AA Change: R247L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.7939 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Dopey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dopey2 APN 16 93800026 unclassified probably benign
IGL00492:Dopey2 APN 16 93780782 missense probably benign 0.00
IGL00753:Dopey2 APN 16 93769624 missense probably benign
IGL00832:Dopey2 APN 16 93763401 missense probably benign 0.01
IGL00939:Dopey2 APN 16 93774083 missense possibly damaging 0.83
IGL01019:Dopey2 APN 16 93810229 missense probably benign 0.32
IGL01288:Dopey2 APN 16 93739293 missense possibly damaging 0.78
IGL01505:Dopey2 APN 16 93757116 missense possibly damaging 0.87
IGL01535:Dopey2 APN 16 93769958 nonsense probably null
IGL01696:Dopey2 APN 16 93770240 missense probably benign 0.00
IGL02077:Dopey2 APN 16 93780760 missense probably damaging 0.96
IGL02163:Dopey2 APN 16 93762427 missense possibly damaging 0.48
IGL02234:Dopey2 APN 16 93752151 missense probably benign
IGL02302:Dopey2 APN 16 93810117 missense probably benign 0.08
IGL02485:Dopey2 APN 16 93770822 missense probably damaging 1.00
IGL02563:Dopey2 APN 16 93777405 missense probably damaging 0.99
IGL02733:Dopey2 APN 16 93739191 missense possibly damaging 0.80
IGL02792:Dopey2 APN 16 93801572 missense possibly damaging 0.75
IGL02941:Dopey2 APN 16 93755473 missense probably benign 0.09
IGL03143:Dopey2 APN 16 93759655 missense probably benign
PIT4519001:Dopey2 UTSW 16 93762054 missense probably benign
R0320:Dopey2 UTSW 16 93810147 missense probably benign 0.02
R0499:Dopey2 UTSW 16 93770437 missense probably benign 0.00
R0501:Dopey2 UTSW 16 93752862 missense probably benign 0.00
R0534:Dopey2 UTSW 16 93762505 missense probably benign 0.04
R0583:Dopey2 UTSW 16 93755486 missense probably benign 0.30
R0626:Dopey2 UTSW 16 93763956 missense probably damaging 1.00
R0724:Dopey2 UTSW 16 93762325 missense probably benign 0.01
R0907:Dopey2 UTSW 16 93801593 missense probably damaging 1.00
R1263:Dopey2 UTSW 16 93777386 missense probably benign
R1378:Dopey2 UTSW 16 93770392 missense probably benign
R1572:Dopey2 UTSW 16 93770153 missense probably damaging 1.00
R1604:Dopey2 UTSW 16 93762570 missense probably benign
R1642:Dopey2 UTSW 16 93762315 missense probably benign 0.00
R1668:Dopey2 UTSW 16 93765516 missense probably damaging 1.00
R1669:Dopey2 UTSW 16 93769660 missense probably damaging 1.00
R1702:Dopey2 UTSW 16 93747621 missense possibly damaging 0.47
R1711:Dopey2 UTSW 16 93799926 missense probably damaging 1.00
R1917:Dopey2 UTSW 16 93716262 missense probably damaging 1.00
R1968:Dopey2 UTSW 16 93782419 missense probably damaging 1.00
R1988:Dopey2 UTSW 16 93766173 missense probably damaging 1.00
R2029:Dopey2 UTSW 16 93769435 missense probably benign 0.36
R2139:Dopey2 UTSW 16 93771007 missense possibly damaging 0.78
R2355:Dopey2 UTSW 16 93770677 missense probably damaging 1.00
R3609:Dopey2 UTSW 16 93739332 missense probably damaging 1.00
R3792:Dopey2 UTSW 16 93771846 missense possibly damaging 0.54
R4364:Dopey2 UTSW 16 93770924 missense probably benign 0.00
R4380:Dopey2 UTSW 16 93716232 missense possibly damaging 0.53
R4455:Dopey2 UTSW 16 93766215 missense probably damaging 1.00
R4779:Dopey2 UTSW 16 93757081 missense probably damaging 1.00
R4820:Dopey2 UTSW 16 93793090 missense probably benign 0.00
R4834:Dopey2 UTSW 16 93740004 start codon destroyed probably null 0.70
R4866:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R4900:Dopey2 UTSW 16 93763430 critical splice donor site probably null
R5153:Dopey2 UTSW 16 93774003 missense probably damaging 0.98
R5176:Dopey2 UTSW 16 93740043 missense probably damaging 1.00
R5206:Dopey2 UTSW 16 93801584 missense probably damaging 1.00
R5320:Dopey2 UTSW 16 93739986 missense probably damaging 1.00
R5361:Dopey2 UTSW 16 93770504 missense probably damaging 1.00
R5380:Dopey2 UTSW 16 93763410 missense probably damaging 0.96
R5476:Dopey2 UTSW 16 93773913 splice site probably null
R5502:Dopey2 UTSW 16 93793226 missense probably benign 0.00
R5543:Dopey2 UTSW 16 93798920 missense probably damaging 0.98
R5557:Dopey2 UTSW 16 93763931 missense probably damaging 0.96
R5901:Dopey2 UTSW 16 93769751 missense possibly damaging 0.88
R5907:Dopey2 UTSW 16 93801581 missense probably damaging 1.00
R6174:Dopey2 UTSW 16 93766222 missense probably damaging 1.00
R6256:Dopey2 UTSW 16 93807214 missense possibly damaging 0.94
R6383:Dopey2 UTSW 16 93782248 missense possibly damaging 0.76
R6525:Dopey2 UTSW 16 93809416 missense probably damaging 1.00
R6554:Dopey2 UTSW 16 93760458 missense probably benign 0.22
R6823:Dopey2 UTSW 16 93755485 missense possibly damaging 0.75
R7036:Dopey2 UTSW 16 93777490 missense probably benign 0.01
R7058:Dopey2 UTSW 16 93776990 missense probably benign 0.00
R7061:Dopey2 UTSW 16 93762063 missense probably benign 0.00
R7209:Dopey2 UTSW 16 93769845 missense probably benign
R7214:Dopey2 UTSW 16 93810135 missense possibly damaging 0.69
R7232:Dopey2 UTSW 16 93760485 critical splice donor site probably null
R7255:Dopey2 UTSW 16 93770146 missense probably damaging 1.00
R7335:Dopey2 UTSW 16 93747508 missense probably benign 0.04
R7535:Dopey2 UTSW 16 93806361 missense probably damaging 1.00
R7763:Dopey2 UTSW 16 93755514 missense probably benign 0.00
R7814:Dopey2 UTSW 16 93799971 missense probably damaging 1.00
R7839:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7862:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7894:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R7922:Dopey2 UTSW 16 93763941 missense probably damaging 1.00
R7945:Dopey2 UTSW 16 93749963 missense probably damaging 1.00
R7977:Dopey2 UTSW 16 93810204 missense probably benign 0.01
R8033:Dopey2 UTSW 16 93769483 missense probably benign
R8061:Dopey2 UTSW 16 93749996 missense probably damaging 1.00
R8067:Dopey2 UTSW 16 93765448 nonsense probably null
Z1088:Dopey2 UTSW 16 93763326 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93769581 missense probably benign 0.00
Z1176:Dopey2 UTSW 16 93803546 missense probably damaging 1.00
Z1176:Dopey2 UTSW 16 93807868 missense possibly damaging 0.82
Z1177:Dopey2 UTSW 16 93763895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGCATGTGTTATGGGCTG -3'
(R):5'- GGTGACTGCACATCAGAACTG -3'

Sequencing Primer
(F):5'- CCAGAGTGTTTAACCAATAATGCCG -3'
(R):5'- TCAGAACTGATAGTGAAAAGCAAC -3'
Posted On2016-03-17