Incidental Mutation 'R4882:H2-Eb2'
ID375358
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Namehistocompatibility 2, class II antigen E beta2
SynonymsA130038H09Rik, Ia5, H-2Eb2, Ia-5
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4882 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34325665-34340229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34334256 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 139 (H139Y)
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
Predicted Effect probably benign
Transcript: ENSMUST00000050325
AA Change: H139Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341
AA Change: H139Y

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Meta Mutation Damage Score 0.8508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34334367 missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34325797 splice site probably null
IGL01380:H2-Eb2 APN 17 34335809 missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34335767 splice site probably benign
IGL02190:H2-Eb2 APN 17 34334374 missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34325687 utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34334244 nonsense probably null
R0510:H2-Eb2 UTSW 17 34334244 nonsense probably null
R1169:H2-Eb2 UTSW 17 34333357 missense possibly damaging 0.89
R1334:H2-Eb2 UTSW 17 34334350 missense probably damaging 0.99
R1598:H2-Eb2 UTSW 17 34334374 missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34334304 missense probably benign 0.15
R4191:H2-Eb2 UTSW 17 34344555 unclassified probably benign
R4194:H2-Eb2 UTSW 17 34333326 missense probably benign
R4461:H2-Eb2 UTSW 17 34333523 missense possibly damaging 0.80
R4774:H2-Eb2 UTSW 17 34334401 missense probably damaging 0.99
R5663:H2-Eb2 UTSW 17 34333408 missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34333549 missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34334421 missense probably benign 0.30
R7457:H2-Eb2 UTSW 17 34334347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCAGGATTAACTTGAGGGAC -3'
(R):5'- ACTCCACTCCACTGTGACAG -3'

Sequencing Primer
(F):5'- CTTGAGGGACAGGTTTAGAATCCC -3'
(R):5'- TGGCAGGTGTAAACCTCTCCAC -3'
Posted On2016-03-17