Incidental Mutation 'R4882:H2-Eb2'
ID 375358
Institutional Source Beutler Lab
Gene Symbol H2-Eb2
Ensembl Gene ENSMUSG00000067341
Gene Name histocompatibility 2, class II antigen E beta2
Synonyms H-2Eb2, Ia5, A130038H09Rik, Ia-5
MMRRC Submission 042490-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4882 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34544639-34560386 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34553230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 139 (H139Y)
Ref Sequence ENSEMBL: ENSMUSP00000056814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050325]
AlphaFold Q3UUV9
Predicted Effect probably benign
Transcript: ENSMUST00000050325
AA Change: H139Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056814
Gene: ENSMUSG00000067341
AA Change: H139Y

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
MHC_II_beta 42 115 8.29e-35 SMART
IGc1 140 211 1.24e-26 SMART
transmembrane domain 227 249 N/A INTRINSIC
Meta Mutation Damage Score 0.8508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,990,112 (GRCm39) D764G probably damaging Het
Adgrg6 T A 10: 14,310,081 (GRCm39) I775F possibly damaging Het
Ahnak T A 19: 8,983,261 (GRCm39) M1515K probably damaging Het
Aqp4 A G 18: 15,531,311 (GRCm39) V150A possibly damaging Het
Axdnd1 A T 1: 156,223,129 (GRCm39) probably null Het
Bap1 C T 14: 30,973,678 (GRCm39) probably benign Het
BB014433 A G 8: 15,092,016 (GRCm39) V279A probably benign Het
Cacng8 T C 7: 3,460,669 (GRCm39) Y151H probably damaging Het
Caskin1 T C 17: 24,723,389 (GRCm39) S726P probably damaging Het
Cd200 T C 16: 45,217,380 (GRCm39) T104A probably benign Het
Cdk12 C T 11: 98,101,272 (GRCm39) R377C unknown Het
Ceacam13 A G 7: 17,746,997 (GRCm39) H150R probably benign Het
Cebpzos T C 17: 79,227,220 (GRCm39) Y65H probably benign Het
Cgnl1 T A 9: 71,624,683 (GRCm39) M630L probably benign Het
Dop1b G T 16: 93,549,802 (GRCm39) R247L possibly damaging Het
Dqx1 A G 6: 83,043,069 (GRCm39) probably null Het
Etaa1 T C 11: 17,896,174 (GRCm39) S648G probably benign Het
Flnb A G 14: 7,929,936 (GRCm38) D2022G possibly damaging Het
Gpr158 T A 2: 21,830,059 (GRCm39) N701K probably damaging Het
Hbb-bh2 A T 7: 103,488,455 (GRCm39) V114E probably damaging Het
Ifna9 T A 4: 88,510,540 (GRCm39) Q28L probably benign Het
Inca1 T C 11: 70,579,566 (GRCm39) T188A probably benign Het
Irf9 G T 14: 55,846,496 (GRCm39) probably benign Het
Kdm1b T A 13: 47,214,369 (GRCm39) H238Q probably benign Het
Lpin1 G C 12: 16,588,537 (GRCm39) F851L probably damaging Het
Map3k9 C T 12: 81,770,936 (GRCm39) R884Q probably damaging Het
Mcm3ap C T 10: 76,320,495 (GRCm39) Q818* probably null Het
Mcm7 A T 5: 138,164,173 (GRCm39) probably null Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Nppa G T 4: 148,085,544 (GRCm39) M50I probably benign Het
Opcml G A 9: 28,812,886 (GRCm39) E193K probably damaging Het
Phf14 T A 6: 11,988,756 (GRCm39) N665K possibly damaging Het
Plekhh3 G A 11: 101,056,009 (GRCm39) A47V probably damaging Het
Plekhh3 T A 11: 101,058,764 (GRCm39) E156V probably null Het
Prpf19 T C 19: 10,876,323 (GRCm39) probably benign Het
Rev3l T A 10: 39,697,456 (GRCm39) V651E possibly damaging Het
Sgpl1 T C 10: 60,948,044 (GRCm39) N171S probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slx4 T C 16: 3,798,860 (GRCm39) probably null Het
Smchd1 T A 17: 71,665,234 (GRCm39) probably benign Het
Snca A G 6: 60,792,719 (GRCm39) V63A probably benign Het
Taok3 A T 5: 117,390,695 (GRCm39) Q92L probably damaging Het
Uhrf1 T C 17: 56,616,401 (GRCm39) V73A probably damaging Het
Usp38 G A 8: 81,708,606 (GRCm39) Q991* probably null Het
Vmn2r96 T A 17: 18,817,866 (GRCm39) V673E probably damaging Het
Zan A G 5: 137,436,710 (GRCm39) Y2048H unknown Het
Zfp759 T A 13: 67,287,354 (GRCm39) Y302N probably damaging Het
Other mutations in H2-Eb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:H2-Eb2 APN 17 34,553,341 (GRCm39) missense probably damaging 0.98
IGL00965:H2-Eb2 APN 17 34,544,771 (GRCm39) splice site probably null
IGL01380:H2-Eb2 APN 17 34,554,783 (GRCm39) missense probably benign 0.41
IGL02057:H2-Eb2 APN 17 34,554,741 (GRCm39) splice site probably benign
IGL02190:H2-Eb2 APN 17 34,553,348 (GRCm39) missense probably damaging 1.00
IGL02220:H2-Eb2 APN 17 34,544,661 (GRCm39) utr 5 prime probably benign
R0469:H2-Eb2 UTSW 17 34,553,218 (GRCm39) nonsense probably null
R0510:H2-Eb2 UTSW 17 34,553,218 (GRCm39) nonsense probably null
R1169:H2-Eb2 UTSW 17 34,552,331 (GRCm39) missense possibly damaging 0.89
R1334:H2-Eb2 UTSW 17 34,553,324 (GRCm39) missense probably damaging 0.99
R1598:H2-Eb2 UTSW 17 34,553,348 (GRCm39) missense probably damaging 1.00
R1991:H2-Eb2 UTSW 17 34,553,278 (GRCm39) missense probably benign 0.15
R2103:H2-Eb2 UTSW 17 34,553,278 (GRCm39) missense probably benign 0.15
R4191:H2-Eb2 UTSW 17 34,563,529 (GRCm39) unclassified probably benign
R4194:H2-Eb2 UTSW 17 34,552,300 (GRCm39) missense probably benign
R4461:H2-Eb2 UTSW 17 34,552,497 (GRCm39) missense possibly damaging 0.80
R4774:H2-Eb2 UTSW 17 34,553,375 (GRCm39) missense probably damaging 0.99
R5663:H2-Eb2 UTSW 17 34,552,382 (GRCm39) missense possibly damaging 0.92
R6913:H2-Eb2 UTSW 17 34,552,523 (GRCm39) missense possibly damaging 0.89
R7139:H2-Eb2 UTSW 17 34,553,395 (GRCm39) missense probably benign 0.30
R7457:H2-Eb2 UTSW 17 34,553,321 (GRCm39) missense probably damaging 1.00
R9173:H2-Eb2 UTSW 17 34,552,491 (GRCm39) missense probably benign 0.37
Z1176:H2-Eb2 UTSW 17 34,553,283 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CTGTCAGGATTAACTTGAGGGAC -3'
(R):5'- ACTCCACTCCACTGTGACAG -3'

Sequencing Primer
(F):5'- CTTGAGGGACAGGTTTAGAATCCC -3'
(R):5'- TGGCAGGTGTAAACCTCTCCAC -3'
Posted On 2016-03-17