Mutagenetix > Incidental Mutations

Incidental Mutation 'R0281:Atr'

37536

Institutional Source

Beutler Lab

Gene Symbol

Atr

Ensembl Gene

ENSMUSG00000032409

Gene Name

ataxia telangiectasia and Rad3 related

Synonyms

MMRRC Submission

038503-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0281 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95857597-95951781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95937566 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2202 (I2202T)

Ref Sequence

ENSEMBL: ENSMUSP00000149953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]

Predicted Effect

probably benign
Transcript: ENSMUST00000034980
AA Change: I2196T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: I2196T

Domain	Start	End	E-Value	Type
low complexity region	431	449	N/A	INTRINSIC
low complexity region	889	897	N/A	INTRINSIC
low complexity region	998	1013	N/A	INTRINSIC
UME	1119	1225	2.3e-43	SMART
low complexity region	1352	1362	N/A	INTRINSIC
Pfam:FAT	1771	2092	9.2e-51	PFAM
PI3Kc	2320	2630	7.51e-124	SMART
FATC	2609	2641	6.22e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180727

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186524

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188088

Predicted Effect

probably benign
Transcript: ENSMUST00000215311
AA Change: I2202T

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.1151

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Atr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Atr	APN	9	95865052	missense	probably damaging	1.00
IGL00922:Atr	APN	9	95907345	missense	probably damaging	0.97
IGL01020:Atr	APN	9	95862783	missense	probably damaging	1.00
IGL01345:Atr	APN	9	95940949	missense	probably damaging	1.00
IGL01364:Atr	APN	9	95865624	missense	probably benign	0.29
IGL01456:Atr	APN	9	95950565	missense	possibly damaging	0.62
IGL01534:Atr	APN	9	95865546	missense	probably damaging	0.99
IGL01761:Atr	APN	9	95951448	splice site	probably benign
IGL01791:Atr	APN	9	95921781	missense	probably benign	0.05
IGL01831:Atr	APN	9	95870754	missense	probably benign	0.18
IGL01973:Atr	APN	9	95871674	missense	probably damaging	1.00
IGL02008:Atr	APN	9	95881420	splice site	probably benign
IGL02016:Atr	APN	9	95927175	missense	probably benign	0.09
IGL02035:Atr	APN	9	95866682	missense	probably benign	0.01
IGL02058:Atr	APN	9	95871487	missense	probably damaging	0.99
IGL02081:Atr	APN	9	95883205	missense	probably damaging	1.00
IGL02224:Atr	APN	9	95878629	missense	probably damaging	0.98
IGL02234:Atr	APN	9	95947250	splice site	probably benign
IGL02367:Atr	APN	9	95899141	nonsense	probably null
IGL02621:Atr	APN	9	95908400	missense	probably benign	0.00
IGL02728:Atr	APN	9	95936475	missense	probably damaging	1.00
IGL02833:Atr	APN	9	95862852	missense	probably damaging	1.00
IGL02939:Atr	APN	9	95865261	missense	probably benign
IGL03107:Atr	APN	9	95897730	missense	probably benign	0.28
IGL03382:Atr	APN	9	95920822	nonsense	probably null
PIT4812001:Atr	UTSW	9	95910649	missense	probably benign	0.41
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0282:Atr	UTSW	9	95862798	missense	probably benign	0.12
R0512:Atr	UTSW	9	95935526	missense	probably damaging	0.99
R0547:Atr	UTSW	9	95899165	splice site	probably benign
R0567:Atr	UTSW	9	95865829	missense	probably benign	0.00
R0631:Atr	UTSW	9	95874777	missense	possibly damaging	0.92
R1116:Atr	UTSW	9	95867636	nonsense	probably null
R1171:Atr	UTSW	9	95907323	missense	probably damaging	1.00
R1241:Atr	UTSW	9	95950636	missense	probably benign	0.08
R1345:Atr	UTSW	9	95920355	missense	probably benign	0.25
R1400:Atr	UTSW	9	95862848	missense	probably benign	0.32
R1413:Atr	UTSW	9	95932442	missense	probably damaging	1.00
R1527:Atr	UTSW	9	95870043	missense	possibly damaging	0.82
R1557:Atr	UTSW	9	95871449	missense	probably damaging	1.00
R1591:Atr	UTSW	9	95945385	missense	probably damaging	1.00
R1602:Atr	UTSW	9	95951557	missense	probably damaging	1.00
R1605:Atr	UTSW	9	95936463	missense	probably damaging	1.00
R1670:Atr	UTSW	9	95861456	missense	probably benign	0.38
R1709:Atr	UTSW	9	95871076	missense	probably benign	0.00
R1728:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1729:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1739:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1816:Atr	UTSW	9	95866694	missense	probably benign	0.00
R1824:Atr	UTSW	9	95936421	missense	probably damaging	1.00
R1844:Atr	UTSW	9	95905817	missense	probably benign	0.01
R1857:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1858:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1866:Atr	UTSW	9	95870605	splice site	probably null
R1913:Atr	UTSW	9	95866733	missense	probably benign	0.01
R2042:Atr	UTSW	9	95870022	missense	probably benign	0.00
R2210:Atr	UTSW	9	95907300	missense	probably damaging	1.00
R2230:Atr	UTSW	9	95920765	missense	probably damaging	1.00
R2361:Atr	UTSW	9	95871157	missense	probably benign	0.41
R2399:Atr	UTSW	9	95871599	missense	probably benign	0.00
R2431:Atr	UTSW	9	95862892	missense	probably benign	0.24
R2860:Atr	UTSW	9	95874243	missense	probably benign	0.07
R2861:Atr	UTSW	9	95874243	missense	probably benign	0.07
R3019:Atr	UTSW	9	95905818	missense	possibly damaging	0.52
R3684:Atr	UTSW	9	95920400	missense	probably damaging	0.96
R4155:Atr	UTSW	9	95888124	nonsense	probably null
R4295:Atr	UTSW	9	95874426	missense	probably benign	0.04
R4359:Atr	UTSW	9	95951536	missense	probably damaging	1.00
R4506:Atr	UTSW	9	95865237	missense	probably benign	0.21
R4523:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R4536:Atr	UTSW	9	95874418	missense	probably benign	0.26
R4588:Atr	UTSW	9	95865667	missense	probably benign
R4646:Atr	UTSW	9	95871197	critical splice donor site	probably null
R4702:Atr	UTSW	9	95920355	missense	possibly damaging	0.92
R4743:Atr	UTSW	9	95862792	missense	probably benign	0.14
R4782:Atr	UTSW	9	95862797	missense	probably benign	0.00
R4928:Atr	UTSW	9	95907299	missense	probably damaging	1.00
R5031:Atr	UTSW	9	95865702	missense	probably damaging	0.98
R5138:Atr	UTSW	9	95937596	missense	probably benign	0.15
R5188:Atr	UTSW	9	95921725	missense	probably benign	0.00
R5219:Atr	UTSW	9	95881238	missense	probably damaging	0.99
R5307:Atr	UTSW	9	95878544	missense	probably benign	0.01
R5414:Atr	UTSW	9	95870704	missense	probably benign	0.00
R5628:Atr	UTSW	9	95874226	nonsense	probably null
R5664:Atr	UTSW	9	95905813	missense	probably benign	0.00
R5678:Atr	UTSW	9	95951487	nonsense	probably null
R5724:Atr	UTSW	9	95866588	missense	probably damaging	1.00
R5759:Atr	UTSW	9	95874402	missense	probably benign	0.01
R5763:Atr	UTSW	9	95945123	missense	probably benign	0.04
R5922:Atr	UTSW	9	95903682	missense	probably benign	0.00
R6051:Atr	UTSW	9	95908369	missense	possibly damaging	0.85
R6161:Atr	UTSW	9	95865319	missense	probably benign
R6171:Atr	UTSW	9	95881271	nonsense	probably null
R6532:Atr	UTSW	9	95908408	missense	probably benign
R6774:Atr	UTSW	9	95927213	missense	probably benign	0.00
R6894:Atr	UTSW	9	95927197	missense	probably damaging	1.00
R6930:Atr	UTSW	9	95866635	missense	probably benign	0.21
R7018:Atr	UTSW	9	95866694	missense	probably benign	0.17
R7056:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R7103:Atr	UTSW	9	95865372	missense	probably damaging	0.98
R7154:Atr	UTSW	9	95865045	missense	probably benign
R7157:Atr	UTSW	9	95869900	missense	probably benign	0.00
R7188:Atr	UTSW	9	95862791	nonsense	probably null
R7189:Atr	UTSW	9	95862791	nonsense	probably null
R7300:Atr	UTSW	9	95865370	missense	probably benign	0.00
R7337:Atr	UTSW	9	95871448	missense	probably damaging	1.00
R7584:Atr	UTSW	9	95942713	missense	probably damaging	1.00
R7602:Atr	UTSW	9	95907383	missense	possibly damaging	0.64
R7633:Atr	UTSW	9	95947118	missense	probably damaging	1.00
R7640:Atr	UTSW	9	95907293	splice site	probably null
R7677:Atr	UTSW	9	95885462	missense	probably damaging	1.00
R7699:Atr	UTSW	9	95875690	nonsense	probably null
R7700:Atr	UTSW	9	95875690	nonsense	probably null
R7790:Atr	UTSW	9	95874180	missense	probably damaging	1.00
R8027:Atr	UTSW	9	95865756	missense	probably damaging	0.99
R8147:Atr	UTSW	9	95899060	missense	probably damaging	1.00
R8204:Atr	UTSW	9	95935513	missense
R8306:Atr	UTSW	9	95920370	missense
R8462:Atr	UTSW	9	95867526	missense	probably benign
X0019:Atr	UTSW	9	95940871	missense	probably damaging	1.00
Z1088:Atr	UTSW	9	95885320	splice site	probably null
Z1177:Atr	UTSW	9	95888100	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTGTTGTGCTACATCCAAAATATTGGATTGT -3'
(R):5'- CCTGTGCCCTGAAATATACCCTGAAAA -3'

Sequencing Primer
(F):5'- TCACAAGCTGTAGGATTAAAATGGTG -3'
(R):5'- gtttagcaagatcaggtttctaattc -3'

Posted On

2013-05-23