Mutagenetix > Incidental Mutations

Incidental Mutation 'R4883:Ptpn14'

375371

Institutional Source

Beutler Lab

Gene Symbol

Ptpn14

Ensembl Gene

ENSMUSG00000026604

Gene Name

protein tyrosine phosphatase, non-receptor type 14

Synonyms

C130080N23Rik, PTP36, OTTMUSG00000022087

MMRRC Submission

042491-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

189728268-189876695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 189850800 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 615 (P615S)

Ref Sequence

ENSEMBL: ENSMUSP00000095051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]

Predicted Effect

probably benign
Transcript: ENSMUST00000027898

SMART Domains

Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097442
AA Change: P615S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: P615S

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195038

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,245,103	N52I	probably damaging	Het
Abca5	T	C	11: 110,326,631	D133G	probably damaging	Het
Abcg4	G	T	9: 44,279,319	H55Q	probably damaging	Het
Acaca	T	A	11: 84,251,290	V641E	probably benign	Het
Adam28	T	C	14: 68,638,103	I229V	probably damaging	Het
Adgrl3	T	A	5: 81,689,646	I793N	probably damaging	Het
Akr1d1	A	T	6: 37,558,401	D240V	possibly damaging	Het
Arhgef25	T	C	10: 127,182,933	D548G	probably benign	Het
Asl	A	G	5: 130,013,961		probably null	Het
Atg14	C	T	14: 47,551,314	R194Q	probably damaging	Het
BC004004	T	A	17: 29,282,192	F38L	probably damaging	Het
Btg1	T	C	10: 96,617,397	F25L	probably benign	Het
Btrc	C	T	19: 45,456,587	P35S	probably benign	Het
Calcr	T	A	6: 3,714,705	N142Y	probably damaging	Het
Ccdc138	A	G	10: 58,561,996	I553V	probably benign	Het
Cdc42	T	A	4: 137,328,804	N132I	probably benign	Het
Ces1e	A	G	8: 93,224,088	S22P	probably benign	Het
Clmn	G	T	12: 104,782,048	D413E	probably benign	Het
Cramp1l	T	C	17: 24,982,319	T730A	probably benign	Het
Dnah5	A	T	15: 28,343,638	M2395L	probably benign	Het
Ephx1	G	T	1: 181,001,923	S20Y	possibly damaging	Het
Exoc5	T	G	14: 49,052,364	E19A	probably damaging	Het
Fam120b	T	C	17: 15,403,032	L424P	probably benign	Het
Fam89a	G	A	8: 124,741,084	T163I	possibly damaging	Het
Fcrls	G	A	3: 87,259,615	L24F	possibly damaging	Het
Fgd6	G	T	10: 94,139,853	V1377L	probably benign	Het
Glud1	T	A	14: 34,335,390	I337K	possibly damaging	Het
Gm6370	T	A	5: 146,493,926	I303N	probably benign	Het
Gm7995	T	C	14: 42,311,426	Y88H	probably damaging	Het
Gsdma3	T	C	11: 98,629,567		probably null	Het
Gsdmc2	T	C	15: 63,835,765	D60G	probably damaging	Het
Hcn1	T	A	13: 117,902,895		probably null	Het
Hectd1	A	T	12: 51,784,247	C936*	probably null	Het
Herc4	T	A	10: 63,285,654	S358T	probably benign	Het
Hk3	A	G	13: 55,010,922	C515R	probably benign	Het
Ighg1	A	G	12: 113,327,518		probably benign	Het
Iqgap3	T	A	3: 88,107,535	C853S	probably benign	Het
Irx4	G	A	13: 73,267,631	A180T	probably damaging	Het
Kif20b	A	G	19: 34,966,122	T1441A	probably benign	Het
Lifr	A	G	15: 7,185,625	K738E	possibly damaging	Het
Lmntd2	A	T	7: 141,212,618	S218T	probably damaging	Het
Lnx1	A	T	5: 74,607,869	W353R	probably benign	Het
Lrfn3	G	T	7: 30,355,813	P569Q	possibly damaging	Het
Mamstr	A	G	7: 45,644,414	I11V	probably benign	Het
Med31	T	C	11: 72,214,149	N32S	possibly damaging	Het
Mob3c	A	T	4: 115,833,731	I173F	probably benign	Het
Morc3	A	G	16: 93,870,362		probably null	Het
Mphosph9	T	C	5: 124,299,045	K412R	probably damaging	Het
Mthfd1l	C	T	10: 4,007,775	P271S	probably benign	Het
Ncam1	C	T	9: 49,541,883		probably null	Het
Ncbp3	T	A	11: 73,069,752	Y279N	probably damaging	Het
Ncoa6	G	A	2: 155,406,767	T1539I	probably benign	Het
Nedd4	G	A	9: 72,740,233		probably null	Het
Neil1	A	G	9: 57,146,922	V38A	probably damaging	Het
Ngf	T	A	3: 102,520,645	F237I	probably damaging	Het
Nol3	A	G	8: 105,279,256	Q94R	possibly damaging	Het
Obox1	A	G	7: 15,556,338	N202S	probably damaging	Het
Odc1	T	A	12: 17,547,385	N29K	possibly damaging	Het
Olfr1241	C	T	2: 89,482,308	V276I	probably benign	Het
Olfr132	T	C	17: 38,130,617	T192A	probably damaging	Het
Olfr1535	C	T	13: 21,555,488	R178H	probably benign	Het
Olfr243	A	C	7: 103,716,707	I38L	probably benign	Het
P2rx7	T	A	5: 122,681,066	V517E	probably damaging	Het
Parm1	A	G	5: 91,593,916	T48A	possibly damaging	Het
Pcdh9	T	A	14: 93,888,728	D2V	possibly damaging	Het
Pgm3	G	T	9: 86,569,325	T92N	probably damaging	Het
Plcg2	G	T	8: 117,607,133	G882*	probably null	Het
Ptprk	A	T	10: 28,588,932	Y1244F	probably damaging	Het
Rere	G	A	4: 150,616,053	A1162T	probably damaging	Het
Rfx2	T	C	17: 56,783,747	E391G	probably damaging	Het
Sema4c	A	G	1: 36,552,016	V414A	probably damaging	Het
Serpinb10	A	T	1: 107,540,951	N185I	probably damaging	Het
Shroom3	T	G	5: 92,951,134	M1410R	probably benign	Het
Slc13a1	A	T	6: 24,134,357	S176T	probably benign	Het
Sntb1	A	T	15: 55,642,802	Y458*	probably null	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Sorcs1	C	T	19: 50,232,303	V570I	probably benign	Het
Sp8	T	A	12: 118,849,070	V220E	probably damaging	Het
Spry1	C	T	3: 37,642,719	T37M	possibly damaging	Het
Sspo	A	T	6: 48,460,822	H1305L	probably benign	Het
Tbc1d22a	A	G	15: 86,496,916	D509G	possibly damaging	Het
Tmem108	A	T	9: 103,499,077	V391D	possibly damaging	Het
Tmem132d	T	A	5: 128,269,300	I53F	probably damaging	Het
Tmem132d	T	A	5: 128,269,302	H52L	possibly damaging	Het
Tnnt2	A	T	1: 135,847,758	R87*	probably null	Het
Ube3a	A	T	7: 59,243,450	M1L	probably benign	Het
Unc79	A	G	12: 103,094,333	T1119A	probably damaging	Het
Usf3	A	T	16: 44,219,579	H1474L	probably damaging	Het
Vcpip1	G	A	1: 9,747,198	T320I	probably damaging	Het
Vmn1r56	A	G	7: 5,196,444	L58P	probably damaging	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Zbtb40	T	A	4: 137,000,930	R459W	probably benign	Het
Zfc3h1	T	A	10: 115,410,642	L878Q	probably damaging	Het
Zfp286	T	C	11: 62,780,629	D206G	probably benign	Het
Zfp46	T	A	4: 136,290,481	C209S	probably damaging	Het
Zufsp	G	T	10: 33,949,042	T148K	probably damaging	Het

Other mutations in Ptpn14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Ptpn14	APN	1	189822633	missense	probably damaging	1.00
IGL02501:Ptpn14	APN	1	189850390	missense	probably benign	0.14
IGL03011:Ptpn14	APN	1	189839557	missense	probably damaging	1.00
R0724:Ptpn14	UTSW	1	189850947	missense	possibly damaging	0.52
R0791:Ptpn14	UTSW	1	189836440	splice site	probably benign
R1363:Ptpn14	UTSW	1	189798628	missense	probably damaging	1.00
R1605:Ptpn14	UTSW	1	189865512	missense	probably benign	0.00
R1840:Ptpn14	UTSW	1	189786851	missense	probably damaging	1.00
R1845:Ptpn14	UTSW	1	189839502	missense	possibly damaging	0.96
R1891:Ptpn14	UTSW	1	189798653	missense	probably damaging	1.00
R2187:Ptpn14	UTSW	1	189863228	nonsense	probably null
R2288:Ptpn14	UTSW	1	189865498	missense	probably damaging	1.00
R3686:Ptpn14	UTSW	1	189851399	missense	probably damaging	1.00
R3895:Ptpn14	UTSW	1	189850546	missense	probably benign	0.31
R3898:Ptpn14	UTSW	1	189850531	missense	probably benign	0.35
R4004:Ptpn14	UTSW	1	189850510	missense	probably benign	0.00
R4816:Ptpn14	UTSW	1	189856800	missense	probably damaging	1.00
R4928:Ptpn14	UTSW	1	189822642	missense	probably damaging	1.00
R4931:Ptpn14	UTSW	1	189851277	missense	probably benign
R4957:Ptpn14	UTSW	1	189851272	missense	probably benign	0.02
R5009:Ptpn14	UTSW	1	189850534	missense	probably benign
R5038:Ptpn14	UTSW	1	189786886	missense	probably damaging	1.00
R5264:Ptpn14	UTSW	1	189832800	critical splice donor site	probably null
R5373:Ptpn14	UTSW	1	189850963	missense	probably benign
R5441:Ptpn14	UTSW	1	189798570	missense	probably damaging	1.00
R5540:Ptpn14	UTSW	1	189846364	missense	probably benign	0.05
R5638:Ptpn14	UTSW	1	189786841	missense	probably damaging	1.00
R5746:Ptpn14	UTSW	1	189846413	critical splice donor site	probably null
R5872:Ptpn14	UTSW	1	189851032	missense	probably benign	0.00
R5988:Ptpn14	UTSW	1	189850387	missense	probably damaging	1.00
R6139:Ptpn14	UTSW	1	189851165	missense	probably benign	0.01
R6295:Ptpn14	UTSW	1	189850800	missense	probably damaging	0.99
R6770:Ptpn14	UTSW	1	189832773	missense	probably damaging	1.00
R7097:Ptpn14	UTSW	1	189863398	nonsense	probably null
R7320:Ptpn14	UTSW	1	189832759	missense	probably benign	0.11
R7324:Ptpn14	UTSW	1	189863424	missense	possibly damaging	0.46
R7599:Ptpn14	UTSW	1	189850745	missense	probably benign	0.39
R7699:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R7700:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R8379:Ptpn14	UTSW	1	189833401	missense	possibly damaging	0.95
Z1177:Ptpn14	UTSW	1	189860470	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGCACTCCAGAACTAGCC -3'
(R):5'- CGAGCCATGGGGATATTGAG -3'

Sequencing Primer
(F):5'- AACATGCAGCTCCAAGGAG -3'
(R):5'- AGTGACTTCAGTGTCATGGCCTC -3'

Posted On

2016-03-17