Incidental Mutation 'R4883:Shroom3'
ID 375390
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 042491-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4883 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 93098993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 1410 (M1410R)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000113051
AA Change: M1316R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: M1316R

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113054
AA Change: M1316R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: M1316R

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113055
AA Change: M1491R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: M1491R

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: M1360R
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: M1360R

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect probably benign
Transcript: ENSMUST00000225438
AA Change: M1410R

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,217,457 (GRCm39) D133G probably damaging Het
Abcg4 G T 9: 44,190,616 (GRCm39) H55Q probably damaging Het
Acaca T A 11: 84,142,116 (GRCm39) V641E probably benign Het
Adam28 T C 14: 68,875,552 (GRCm39) I229V probably damaging Het
Adgrl3 T A 5: 81,837,493 (GRCm39) I793N probably damaging Het
Akr1d1 A T 6: 37,535,336 (GRCm39) D240V possibly damaging Het
Arhgef25 T C 10: 127,018,802 (GRCm39) D548G probably benign Het
Asl A G 5: 130,042,802 (GRCm39) probably null Het
Atg14 C T 14: 47,788,771 (GRCm39) R194Q probably damaging Het
BC004004 T A 17: 29,501,166 (GRCm39) F38L probably damaging Het
Btg1 T C 10: 96,453,259 (GRCm39) F25L probably benign Het
Btrc C T 19: 45,445,026 (GRCm39) P35S probably benign Het
Calcr T A 6: 3,714,705 (GRCm39) N142Y probably damaging Het
Ccdc138 A G 10: 58,397,818 (GRCm39) I553V probably benign Het
Ccdc198 T A 14: 49,482,560 (GRCm39) N52I probably damaging Het
Cdc42 T A 4: 137,056,115 (GRCm39) N132I probably benign Het
Ces1e A G 8: 93,950,716 (GRCm39) S22P probably benign Het
Clmn G T 12: 104,748,307 (GRCm39) D413E probably benign Het
Cramp1 T C 17: 25,201,293 (GRCm39) T730A probably benign Het
Dnah5 A T 15: 28,343,784 (GRCm39) M2395L probably benign Het
Ephx1 G T 1: 180,829,488 (GRCm39) S20Y possibly damaging Het
Exoc5 T G 14: 49,289,821 (GRCm39) E19A probably damaging Het
Fam120b T C 17: 15,623,294 (GRCm39) L424P probably benign Het
Fam89a G A 8: 125,467,823 (GRCm39) T163I possibly damaging Het
Fcrl2 G A 3: 87,166,922 (GRCm39) L24F possibly damaging Het
Fgd6 G T 10: 93,975,715 (GRCm39) V1377L probably benign Het
Glud1 T A 14: 34,057,347 (GRCm39) I337K possibly damaging Het
Gm6370 T A 5: 146,430,736 (GRCm39) I303N probably benign Het
Gm7995 T C 14: 42,133,383 (GRCm39) Y88H probably damaging Het
Gsdma3 T C 11: 98,520,393 (GRCm39) probably null Het
Gsdmc2 T C 15: 63,707,614 (GRCm39) D60G probably damaging Het
Hcn1 T A 13: 118,039,431 (GRCm39) probably null Het
Hectd1 A T 12: 51,831,030 (GRCm39) C936* probably null Het
Herc4 T A 10: 63,121,433 (GRCm39) S358T probably benign Het
Hk3 A G 13: 55,158,735 (GRCm39) C515R probably benign Het
Ighg1 A G 12: 113,291,138 (GRCm39) probably benign Het
Iqgap3 T A 3: 88,014,842 (GRCm39) C853S probably benign Het
Irx4 G A 13: 73,415,750 (GRCm39) A180T probably damaging Het
Kif20b A G 19: 34,943,522 (GRCm39) T1441A probably benign Het
Lifr A G 15: 7,215,106 (GRCm39) K738E possibly damaging Het
Lmntd2 A T 7: 140,792,531 (GRCm39) S218T probably damaging Het
Lnx1 A T 5: 74,768,530 (GRCm39) W353R probably benign Het
Lrfn3 G T 7: 30,055,238 (GRCm39) P569Q possibly damaging Het
Mamstr A G 7: 45,293,838 (GRCm39) I11V probably benign Het
Med31 T C 11: 72,104,975 (GRCm39) N32S possibly damaging Het
Mob3c A T 4: 115,690,928 (GRCm39) I173F probably benign Het
Morc3 A G 16: 93,667,250 (GRCm39) probably null Het
Mphosph9 T C 5: 124,437,108 (GRCm39) K412R probably damaging Het
Mtcl3 A T 10: 29,072,537 (GRCm39) N610Y probably damaging Het
Mthfd1l C T 10: 3,957,775 (GRCm39) P271S probably benign Het
Ncam1 C T 9: 49,453,183 (GRCm39) probably null Het
Ncbp3 T A 11: 72,960,578 (GRCm39) Y279N probably damaging Het
Ncoa6 G A 2: 155,248,687 (GRCm39) T1539I probably benign Het
Nedd4 G A 9: 72,647,515 (GRCm39) probably null Het
Neil1 A G 9: 57,054,206 (GRCm39) V38A probably damaging Het
Ngf T A 3: 102,427,961 (GRCm39) F237I probably damaging Het
Nol3 A G 8: 106,005,888 (GRCm39) Q94R possibly damaging Het
Obox1 A G 7: 15,290,263 (GRCm39) N202S probably damaging Het
Odc1 T A 12: 17,597,386 (GRCm39) N29K possibly damaging Het
Or2b7 C T 13: 21,739,658 (GRCm39) R178H probably benign Het
Or2h15 T C 17: 38,441,508 (GRCm39) T192A probably damaging Het
Or4a69 C T 2: 89,312,652 (GRCm39) V276I probably benign Het
Or52a20 A C 7: 103,365,914 (GRCm39) I38L probably benign Het
P2rx7 T A 5: 122,819,129 (GRCm39) V517E probably damaging Het
Parm1 A G 5: 91,741,775 (GRCm39) T48A possibly damaging Het
Pcdh9 T A 14: 94,126,164 (GRCm39) D2V possibly damaging Het
Pgm3 G T 9: 86,451,378 (GRCm39) T92N probably damaging Het
Plcg2 G T 8: 118,333,872 (GRCm39) G882* probably null Het
Ptpn14 C T 1: 189,582,997 (GRCm39) P615S probably damaging Het
Ptprk A T 10: 28,464,928 (GRCm39) Y1244F probably damaging Het
Rere G A 4: 150,700,510 (GRCm39) A1162T probably damaging Het
Rfx2 T C 17: 57,090,747 (GRCm39) E391G probably damaging Het
Sema4c A G 1: 36,591,097 (GRCm39) V414A probably damaging Het
Serpinb10 A T 1: 107,468,681 (GRCm39) N185I probably damaging Het
Slc13a1 A T 6: 24,134,356 (GRCm39) S176T probably benign Het
Sntb1 A T 15: 55,506,198 (GRCm39) Y458* probably null Het
Sorcs1 C T 19: 50,220,741 (GRCm39) V570I probably benign Het
Sp8 T A 12: 118,812,805 (GRCm39) V220E probably damaging Het
Spry1 C T 3: 37,696,868 (GRCm39) T37M possibly damaging Het
Sspo A T 6: 48,437,756 (GRCm39) H1305L probably benign Het
Tbc1d22a A G 15: 86,381,117 (GRCm39) D509G possibly damaging Het
Tmem108 A T 9: 103,376,276 (GRCm39) V391D possibly damaging Het
Tmem132d T A 5: 128,346,366 (GRCm39) H52L possibly damaging Het
Tmem132d T A 5: 128,346,364 (GRCm39) I53F probably damaging Het
Tnnt2 A T 1: 135,775,496 (GRCm39) R87* probably null Het
Ube3a A T 7: 58,893,198 (GRCm39) M1L probably benign Het
Unc79 A G 12: 103,060,592 (GRCm39) T1119A probably damaging Het
Usf3 A T 16: 44,039,942 (GRCm39) H1474L probably damaging Het
Vcpip1 G A 1: 9,817,423 (GRCm39) T320I probably damaging Het
Vmn1r56 A G 7: 5,199,443 (GRCm39) L58P probably damaging Het
Wdr53 A T 16: 32,075,796 (GRCm39) K334* probably null Het
Zbtb40 T A 4: 136,728,241 (GRCm39) R459W probably benign Het
Zfc3h1 T A 10: 115,246,547 (GRCm39) L878Q probably damaging Het
Zfp286 T C 11: 62,671,455 (GRCm39) D206G probably benign Het
Zfp46 T A 4: 136,017,792 (GRCm39) C209S probably damaging Het
Zup1 G T 10: 33,825,038 (GRCm39) T148K probably damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCAGTCCAAGAAGCCCTG -3'
(R):5'- CTGGTCAACACCTGAGAGTGAAG -3'

Sequencing Primer
(F):5'- TTGCTGAGGACACCTTGGC -3'
(R):5'- AGTGAAGGATGGCCGCTTC -3'
Posted On 2016-03-17