Mutagenetix > Incidental Mutation

Incidental Mutation 'R4883:Shroom3'

375390

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

042491-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 92951134 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 1410 (M1410R)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: M1316R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: M1316R

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: M1316R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: M1316R

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: M1491R

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: M1491R

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: M1360R

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: M1360R

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

probably benign
Transcript: ENSMUST00000225438
AA Change: M1410R

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,245,103	N52I	probably damaging	Het
Abca5	T	C	11: 110,326,631	D133G	probably damaging	Het
Abcg4	G	T	9: 44,279,319	H55Q	probably damaging	Het
Acaca	T	A	11: 84,251,290	V641E	probably benign	Het
Adam28	T	C	14: 68,638,103	I229V	probably damaging	Het
Adgrl3	T	A	5: 81,689,646	I793N	probably damaging	Het
Akr1d1	A	T	6: 37,558,401	D240V	possibly damaging	Het
Arhgef25	T	C	10: 127,182,933	D548G	probably benign	Het
Asl	A	G	5: 130,013,961		probably null	Het
Atg14	C	T	14: 47,551,314	R194Q	probably damaging	Het
BC004004	T	A	17: 29,282,192	F38L	probably damaging	Het
Btg1	T	C	10: 96,617,397	F25L	probably benign	Het
Btrc	C	T	19: 45,456,587	P35S	probably benign	Het
Calcr	T	A	6: 3,714,705	N142Y	probably damaging	Het
Ccdc138	A	G	10: 58,561,996	I553V	probably benign	Het
Cdc42	T	A	4: 137,328,804	N132I	probably benign	Het
Ces1e	A	G	8: 93,224,088	S22P	probably benign	Het
Clmn	G	T	12: 104,782,048	D413E	probably benign	Het
Cramp1l	T	C	17: 24,982,319	T730A	probably benign	Het
Dnah5	A	T	15: 28,343,638	M2395L	probably benign	Het
Ephx1	G	T	1: 181,001,923	S20Y	possibly damaging	Het
Exoc5	T	G	14: 49,052,364	E19A	probably damaging	Het
Fam120b	T	C	17: 15,403,032	L424P	probably benign	Het
Fam89a	G	A	8: 124,741,084	T163I	possibly damaging	Het
Fcrls	G	A	3: 87,259,615	L24F	possibly damaging	Het
Fgd6	G	T	10: 94,139,853	V1377L	probably benign	Het
Glud1	T	A	14: 34,335,390	I337K	possibly damaging	Het
Gm6370	T	A	5: 146,493,926	I303N	probably benign	Het
Gm7995	T	C	14: 42,311,426	Y88H	probably damaging	Het
Gsdma3	T	C	11: 98,629,567		probably null	Het
Gsdmc2	T	C	15: 63,835,765	D60G	probably damaging	Het
Hcn1	T	A	13: 117,902,895		probably null	Het
Hectd1	A	T	12: 51,784,247	C936*	probably null	Het
Herc4	T	A	10: 63,285,654	S358T	probably benign	Het
Hk3	A	G	13: 55,010,922	C515R	probably benign	Het
Ighg1	A	G	12: 113,327,518		probably benign	Het
Iqgap3	T	A	3: 88,107,535	C853S	probably benign	Het
Irx4	G	A	13: 73,267,631	A180T	probably damaging	Het
Kif20b	A	G	19: 34,966,122	T1441A	probably benign	Het
Lifr	A	G	15: 7,185,625	K738E	possibly damaging	Het
Lmntd2	A	T	7: 141,212,618	S218T	probably damaging	Het
Lnx1	A	T	5: 74,607,869	W353R	probably benign	Het
Lrfn3	G	T	7: 30,355,813	P569Q	possibly damaging	Het
Mamstr	A	G	7: 45,644,414	I11V	probably benign	Het
Med31	T	C	11: 72,214,149	N32S	possibly damaging	Het
Mob3c	A	T	4: 115,833,731	I173F	probably benign	Het
Morc3	A	G	16: 93,870,362		probably null	Het
Mphosph9	T	C	5: 124,299,045	K412R	probably damaging	Het
Mthfd1l	C	T	10: 4,007,775	P271S	probably benign	Het
Ncam1	C	T	9: 49,541,883		probably null	Het
Ncbp3	T	A	11: 73,069,752	Y279N	probably damaging	Het
Ncoa6	G	A	2: 155,406,767	T1539I	probably benign	Het
Nedd4	G	A	9: 72,740,233		probably null	Het
Neil1	A	G	9: 57,146,922	V38A	probably damaging	Het
Ngf	T	A	3: 102,520,645	F237I	probably damaging	Het
Nol3	A	G	8: 105,279,256	Q94R	possibly damaging	Het
Obox1	A	G	7: 15,556,338	N202S	probably damaging	Het
Odc1	T	A	12: 17,547,385	N29K	possibly damaging	Het
Olfr1241	C	T	2: 89,482,308	V276I	probably benign	Het
Olfr132	T	C	17: 38,130,617	T192A	probably damaging	Het
Olfr1535	C	T	13: 21,555,488	R178H	probably benign	Het
Olfr243	A	C	7: 103,716,707	I38L	probably benign	Het
P2rx7	T	A	5: 122,681,066	V517E	probably damaging	Het
Parm1	A	G	5: 91,593,916	T48A	possibly damaging	Het
Pcdh9	T	A	14: 93,888,728	D2V	possibly damaging	Het
Pgm3	G	T	9: 86,569,325	T92N	probably damaging	Het
Plcg2	G	T	8: 117,607,133	G882*	probably null	Het
Ptpn14	C	T	1: 189,850,800	P615S	probably damaging	Het
Ptprk	A	T	10: 28,588,932	Y1244F	probably damaging	Het
Rere	G	A	4: 150,616,053	A1162T	probably damaging	Het
Rfx2	T	C	17: 56,783,747	E391G	probably damaging	Het
Sema4c	A	G	1: 36,552,016	V414A	probably damaging	Het
Serpinb10	A	T	1: 107,540,951	N185I	probably damaging	Het
Slc13a1	A	T	6: 24,134,357	S176T	probably benign	Het
Sntb1	A	T	15: 55,642,802	Y458*	probably null	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Sorcs1	C	T	19: 50,232,303	V570I	probably benign	Het
Sp8	T	A	12: 118,849,070	V220E	probably damaging	Het
Spry1	C	T	3: 37,642,719	T37M	possibly damaging	Het
Sspo	A	T	6: 48,460,822	H1305L	probably benign	Het
Tbc1d22a	A	G	15: 86,496,916	D509G	possibly damaging	Het
Tmem108	A	T	9: 103,499,077	V391D	possibly damaging	Het
Tmem132d	T	A	5: 128,269,300	I53F	probably damaging	Het
Tmem132d	T	A	5: 128,269,302	H52L	possibly damaging	Het
Tnnt2	A	T	1: 135,847,758	R87*	probably null	Het
Ube3a	A	T	7: 59,243,450	M1L	probably benign	Het
Unc79	A	G	12: 103,094,333	T1119A	probably damaging	Het
Usf3	A	T	16: 44,219,579	H1474L	probably damaging	Het
Vcpip1	G	A	1: 9,747,198	T320I	probably damaging	Het
Vmn1r56	A	G	7: 5,196,444	L58P	probably damaging	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Zbtb40	T	A	4: 137,000,930	R459W	probably benign	Het
Zfc3h1	T	A	10: 115,410,642	L878Q	probably damaging	Het
Zfp286	T	C	11: 62,780,629	D206G	probably benign	Het
Zfp46	T	A	4: 136,290,481	C209S	probably damaging	Het
Zufsp	G	T	10: 33,949,042	T148K	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACCAGTCCAAGAAGCCCTG -3'
(R):5'- CTGGTCAACACCTGAGAGTGAAG -3'

Sequencing Primer
(F):5'- TTGCTGAGGACACCTTGGC -3'
(R):5'- AGTGAAGGATGGCCGCTTC -3'

Posted On

2016-03-17