Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Ptprk'

37540

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0281 (G1)

Quality Score

106

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28573392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 962 (I962F)

Ref Sequence

ENSEMBL: ENSMUSP00000151986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

AlphaFold

P35822

Predicted Effect

probably damaging
Transcript: ENSMUST00000166468
AA Change: I974F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I974F

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000218276
AA Change: I988F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218359
AA Change: I962F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5253

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8919:Ptprk	UTSW	10	28483207	nonsense	probably null
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
R9475:Ptprk	UTSW	10	28334480	missense	possibly damaging	0.60
R9585:Ptprk	UTSW	10	28493151	nonsense	probably null
R9625:Ptprk	UTSW	10	28586010	missense	probably damaging	0.99
R9700:Ptprk	UTSW	10	28580499	missense	probably damaging	1.00
R9745:Ptprk	UTSW	10	28263612	missense	possibly damaging	0.46
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGTTCGAGAAGTGGACCCTGTG -3'
(R):5'- GGTCTTACTGCTCTTCAGGCTGAC -3'

Sequencing Primer
(F):5'- GGACCCTGTGTTCACTACTCAG -3'
(R):5'- CTACTGTCTAGTGGACTGAGATACC -3'

Posted On

2013-05-23