Incidental Mutation 'R0281:Smarcc2'
ID37543
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
MMRRC Submission 038503-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R0281 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128474722 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 407 (T407A)
Ref Sequence ENSEMBL: ENSMUSP00000100868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]
Predicted Effect probably benign
Transcript: ENSMUST00000026433
AA Change: T407A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369
AA Change: T407A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099131
AA Change: T407A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369
AA Change: T407A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105235
AA Change: T407A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369
AA Change: T407A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217751
Predicted Effect probably benign
Transcript: ENSMUST00000218228
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcc5 T A 16: 20,422,400 I12F probably damaging Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cep192 A G 18: 67,828,482 probably benign Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Col6a6 T A 9: 105,784,116 M265L probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hectd4 G A 5: 121,254,251 D193N possibly damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lasp1 C A 11: 97,806,851 C32* probably null Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
PIT4403001:Smarcc2 UTSW 10 128463024 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1718:Smarcc2 UTSW 10 128468998 intron probably benign
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 splice site probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7016:Smarcc2 UTSW 10 128485329 splice site probably null
R7149:Smarcc2 UTSW 10 128482729 missense probably damaging 1.00
R7229:Smarcc2 UTSW 10 128488048 missense unknown
R7395:Smarcc2 UTSW 10 128485606 missense probably damaging 1.00
R7596:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R7722:Smarcc2 UTSW 10 128481728 missense possibly damaging 0.72
R8407:Smarcc2 UTSW 10 128482321 missense probably damaging 1.00
R8468:Smarcc2 UTSW 10 128484393 missense probably benign 0.00
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAATTGTGCCTGCTGCTC -3'
(R):5'- GCATGGACGCTGCAAGATAAATCAC -3'

Sequencing Primer
(F):5'- TCCTGGGTGTAGGAGAAGCT -3'
(R):5'- TCACAACGGGTTTAGAAGGC -3'
Posted On2013-05-23