Mutagenetix > Incidental Mutation

Incidental Mutation 'R4883:Fgd6'

375430

Institutional Source

Beutler Lab

Gene Symbol

Fgd6

Ensembl Gene

ENSMUSG00000020021

Gene Name

FYVE, RhoGEF and PH domain containing 6

Synonyms

Etohd4, ZFYVE24

MMRRC Submission

042491-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.522) question?

Stock #

R4883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94036001-94145339 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 94139853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1377 (V1377L)

Ref Sequence

ENSEMBL: ENSMUSP00000020208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020208]

AlphaFold

Q69ZL1

PDB Structure

Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000020208
AA Change: V1377L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: V1377L

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	24	34	N/A	INTRINSIC
low complexity region	45	60	N/A	INTRINSIC
low complexity region	75	88	N/A	INTRINSIC
low complexity region	150	161	N/A	INTRINSIC
low complexity region	403	418	N/A	INTRINSIC
low complexity region	803	821	N/A	INTRINSIC
RhoGEF	845	1029	3.09e-46	SMART
PH	1060	1155	6.25e-15	SMART
FYVE	1183	1251	6.93e-28	SMART
low complexity region	1268	1282	N/A	INTRINSIC
PH	1303	1398	1.54e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125535

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,245,103	N52I	probably damaging	Het
Abca5	T	C	11: 110,326,631	D133G	probably damaging	Het
Abcg4	G	T	9: 44,279,319	H55Q	probably damaging	Het
Acaca	T	A	11: 84,251,290	V641E	probably benign	Het
Adam28	T	C	14: 68,638,103	I229V	probably damaging	Het
Adgrl3	T	A	5: 81,689,646	I793N	probably damaging	Het
Akr1d1	A	T	6: 37,558,401	D240V	possibly damaging	Het
Arhgef25	T	C	10: 127,182,933	D548G	probably benign	Het
Asl	A	G	5: 130,013,961		probably null	Het
Atg14	C	T	14: 47,551,314	R194Q	probably damaging	Het
BC004004	T	A	17: 29,282,192	F38L	probably damaging	Het
Btg1	T	C	10: 96,617,397	F25L	probably benign	Het
Btrc	C	T	19: 45,456,587	P35S	probably benign	Het
Calcr	T	A	6: 3,714,705	N142Y	probably damaging	Het
Ccdc138	A	G	10: 58,561,996	I553V	probably benign	Het
Cdc42	T	A	4: 137,328,804	N132I	probably benign	Het
Ces1e	A	G	8: 93,224,088	S22P	probably benign	Het
Clmn	G	T	12: 104,782,048	D413E	probably benign	Het
Cramp1l	T	C	17: 24,982,319	T730A	probably benign	Het
Dnah5	A	T	15: 28,343,638	M2395L	probably benign	Het
Ephx1	G	T	1: 181,001,923	S20Y	possibly damaging	Het
Exoc5	T	G	14: 49,052,364	E19A	probably damaging	Het
Fam120b	T	C	17: 15,403,032	L424P	probably benign	Het
Fam89a	G	A	8: 124,741,084	T163I	possibly damaging	Het
Fcrls	G	A	3: 87,259,615	L24F	possibly damaging	Het
Glud1	T	A	14: 34,335,390	I337K	possibly damaging	Het
Gm6370	T	A	5: 146,493,926	I303N	probably benign	Het
Gm7995	T	C	14: 42,311,426	Y88H	probably damaging	Het
Gsdma3	T	C	11: 98,629,567		probably null	Het
Gsdmc2	T	C	15: 63,835,765	D60G	probably damaging	Het
Hcn1	T	A	13: 117,902,895		probably null	Het
Hectd1	A	T	12: 51,784,247	C936*	probably null	Het
Herc4	T	A	10: 63,285,654	S358T	probably benign	Het
Hk3	A	G	13: 55,010,922	C515R	probably benign	Het
Ighg1	A	G	12: 113,327,518		probably benign	Het
Iqgap3	T	A	3: 88,107,535	C853S	probably benign	Het
Irx4	G	A	13: 73,267,631	A180T	probably damaging	Het
Kif20b	A	G	19: 34,966,122	T1441A	probably benign	Het
Lifr	A	G	15: 7,185,625	K738E	possibly damaging	Het
Lmntd2	A	T	7: 141,212,618	S218T	probably damaging	Het
Lnx1	A	T	5: 74,607,869	W353R	probably benign	Het
Lrfn3	G	T	7: 30,355,813	P569Q	possibly damaging	Het
Mamstr	A	G	7: 45,644,414	I11V	probably benign	Het
Med31	T	C	11: 72,214,149	N32S	possibly damaging	Het
Mob3c	A	T	4: 115,833,731	I173F	probably benign	Het
Morc3	A	G	16: 93,870,362		probably null	Het
Mphosph9	T	C	5: 124,299,045	K412R	probably damaging	Het
Mthfd1l	C	T	10: 4,007,775	P271S	probably benign	Het
Ncam1	C	T	9: 49,541,883		probably null	Het
Ncbp3	T	A	11: 73,069,752	Y279N	probably damaging	Het
Ncoa6	G	A	2: 155,406,767	T1539I	probably benign	Het
Nedd4	G	A	9: 72,740,233		probably null	Het
Neil1	A	G	9: 57,146,922	V38A	probably damaging	Het
Ngf	T	A	3: 102,520,645	F237I	probably damaging	Het
Nol3	A	G	8: 105,279,256	Q94R	possibly damaging	Het
Obox1	A	G	7: 15,556,338	N202S	probably damaging	Het
Odc1	T	A	12: 17,547,385	N29K	possibly damaging	Het
Olfr1241	C	T	2: 89,482,308	V276I	probably benign	Het
Olfr132	T	C	17: 38,130,617	T192A	probably damaging	Het
Olfr1535	C	T	13: 21,555,488	R178H	probably benign	Het
Olfr243	A	C	7: 103,716,707	I38L	probably benign	Het
P2rx7	T	A	5: 122,681,066	V517E	probably damaging	Het
Parm1	A	G	5: 91,593,916	T48A	possibly damaging	Het
Pcdh9	T	A	14: 93,888,728	D2V	possibly damaging	Het
Pgm3	G	T	9: 86,569,325	T92N	probably damaging	Het
Plcg2	G	T	8: 117,607,133	G882*	probably null	Het
Ptpn14	C	T	1: 189,850,800	P615S	probably damaging	Het
Ptprk	A	T	10: 28,588,932	Y1244F	probably damaging	Het
Rere	G	A	4: 150,616,053	A1162T	probably damaging	Het
Rfx2	T	C	17: 56,783,747	E391G	probably damaging	Het
Sema4c	A	G	1: 36,552,016	V414A	probably damaging	Het
Serpinb10	A	T	1: 107,540,951	N185I	probably damaging	Het
Shroom3	T	G	5: 92,951,134	M1410R	probably benign	Het
Slc13a1	A	T	6: 24,134,357	S176T	probably benign	Het
Sntb1	A	T	15: 55,642,802	Y458*	probably null	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Sorcs1	C	T	19: 50,232,303	V570I	probably benign	Het
Sp8	T	A	12: 118,849,070	V220E	probably damaging	Het
Spry1	C	T	3: 37,642,719	T37M	possibly damaging	Het
Sspo	A	T	6: 48,460,822	H1305L	probably benign	Het
Tbc1d22a	A	G	15: 86,496,916	D509G	possibly damaging	Het
Tmem108	A	T	9: 103,499,077	V391D	possibly damaging	Het
Tmem132d	T	A	5: 128,269,300	I53F	probably damaging	Het
Tmem132d	T	A	5: 128,269,302	H52L	possibly damaging	Het
Tnnt2	A	T	1: 135,847,758	R87*	probably null	Het
Ube3a	A	T	7: 59,243,450	M1L	probably benign	Het
Unc79	A	G	12: 103,094,333	T1119A	probably damaging	Het
Usf3	A	T	16: 44,219,579	H1474L	probably damaging	Het
Vcpip1	G	A	1: 9,747,198	T320I	probably damaging	Het
Vmn1r56	A	G	7: 5,196,444	L58P	probably damaging	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Zbtb40	T	A	4: 137,000,930	R459W	probably benign	Het
Zfc3h1	T	A	10: 115,410,642	L878Q	probably damaging	Het
Zfp286	T	C	11: 62,780,629	D206G	probably benign	Het
Zfp46	T	A	4: 136,290,481	C209S	probably damaging	Het
Zufsp	G	T	10: 33,949,042	T148K	probably damaging	Het

Other mutations in Fgd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Fgd6	APN	10	94043634	missense	probably benign	0.01
IGL00975:Fgd6	APN	10	94134076	missense	probably damaging	0.98
IGL01366:Fgd6	APN	10	94043476	missense	possibly damaging	0.71
IGL01940:Fgd6	APN	10	94089650	splice site	probably null
IGL01958:Fgd6	APN	10	94138308	missense	probably benign	0.25
IGL01988:Fgd6	APN	10	94074335	splice site	probably benign
IGL02019:Fgd6	APN	10	94133354	missense	probably damaging	1.00
IGL02074:Fgd6	APN	10	94127435	missense	probably damaging	1.00
IGL02227:Fgd6	APN	10	94134084	missense	probably damaging	1.00
IGL02262:Fgd6	APN	10	94125628	missense	probably damaging	0.98
IGL02353:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02360:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02425:Fgd6	APN	10	94074202	missense	probably benign	0.00
IGL02526:Fgd6	APN	10	94100511	missense	probably benign	0.21
IGL02607:Fgd6	APN	10	94044448	missense	possibly damaging	0.94
IGL02741:Fgd6	APN	10	94123290	missense	possibly damaging	0.65
IGL02870:Fgd6	APN	10	94045164	missense	probably damaging	1.00
IGL02884:Fgd6	APN	10	94045639	splice site	probably benign
IGL02995:Fgd6	APN	10	94045480	nonsense	probably null
IGL03189:Fgd6	APN	10	94044456	missense	probably benign	0.26
IGL03258:Fgd6	APN	10	94133353	missense	probably benign	0.44
IGL03396:Fgd6	APN	10	94044456	missense	probably benign	0.26
FR4449:Fgd6	UTSW	10	94044320	small deletion	probably benign
R0257:Fgd6	UTSW	10	94043915	missense	probably benign	0.11
R0926:Fgd6	UTSW	10	94135047	missense	probably benign	0.40
R1325:Fgd6	UTSW	10	94127427	missense	probably damaging	1.00
R1422:Fgd6	UTSW	10	94045372	missense	probably damaging	1.00
R1491:Fgd6	UTSW	10	94044832	missense	probably benign	0.06
R1593:Fgd6	UTSW	10	94045032	missense	probably damaging	1.00
R1624:Fgd6	UTSW	10	94137436	missense	probably benign	0.19
R1929:Fgd6	UTSW	10	94045006	missense	probably benign	0.01
R2064:Fgd6	UTSW	10	94045041	missense	probably damaging	0.98
R2965:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R2966:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R3889:Fgd6	UTSW	10	94089637	missense	probably damaging	1.00
R4094:Fgd6	UTSW	10	94043434	missense	probably damaging	1.00
R4605:Fgd6	UTSW	10	94044355	missense	probably benign	0.12
R5217:Fgd6	UTSW	10	94134077	missense	possibly damaging	0.90
R5473:Fgd6	UTSW	10	94044676	missense	probably benign	0.00
R5606:Fgd6	UTSW	10	94138328	nonsense	probably null
R5644:Fgd6	UTSW	10	94134050	missense	possibly damaging	0.80
R6051:Fgd6	UTSW	10	94137565	critical splice donor site	probably null
R6258:Fgd6	UTSW	10	94044299	missense	probably benign	0.00
R6735:Fgd6	UTSW	10	94074320	missense	possibly damaging	0.94
R7181:Fgd6	UTSW	10	94043511	missense	probably benign	0.02
R7210:Fgd6	UTSW	10	94134092	missense	probably damaging	0.98
R7296:Fgd6	UTSW	10	94044047	nonsense	probably null
R7296:Fgd6	UTSW	10	94139881	missense	probably benign	0.02
R7697:Fgd6	UTSW	10	94045444	missense	probably damaging	0.99
R7747:Fgd6	UTSW	10	94044916	missense	probably damaging	1.00
R7861:Fgd6	UTSW	10	94103331	missense	probably benign	0.15
R7940:Fgd6	UTSW	10	94120482	missense	probably benign	0.02
R8022:Fgd6	UTSW	10	94044344	missense	possibly damaging	0.54
R8138:Fgd6	UTSW	10	94134143	missense	probably null	0.45
R8171:Fgd6	UTSW	10	94074332	critical splice donor site	probably null
R8189:Fgd6	UTSW	10	94074215	missense	probably benign	0.00
R8213:Fgd6	UTSW	10	94044052	missense	probably benign	0.37
R8960:Fgd6	UTSW	10	94045006	missense	probably benign	0.06
R8981:Fgd6	UTSW	10	94045054	missense	possibly damaging	0.80
R8989:Fgd6	UTSW	10	94123563	missense	probably damaging	0.97
R9609:Fgd6	UTSW	10	94043812	missense	probably damaging	0.99
RF031:Fgd6	UTSW	10	94044325	frame shift	probably null
RF040:Fgd6	UTSW	10	94044325	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GTACAGATCAAGACCTTTCAAGC -3'
(R):5'- CAAACAGTATGGGCAGGACCAC -3'

Sequencing Primer
(F):5'- AAGACCTTTCAAGCCTGCCTG -3'
(R):5'- TATGGGCAGGACCACCCATC -3'

Posted On

2016-03-17