Incidental Mutation 'R4883:Zfp286'
ID 375436
Institutional Source Beutler Lab
Gene Symbol Zfp286
Ensembl Gene ENSMUSG00000047342
Gene Name zinc finger protein 286
Synonyms
MMRRC Submission 042491-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4883 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 62643403-62680288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62671455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 206 (D206G)
Ref Sequence ENSEMBL: ENSMUSP00000055517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054654] [ENSMUST00000108705] [ENSMUST00000207597]
AlphaFold Q8C0E6
Predicted Effect probably benign
Transcript: ENSMUST00000054654
AA Change: D206G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000055517
Gene: ENSMUSG00000047342
AA Change: D206G

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
ZnF_C2H2 241 263 2.75e-3 SMART
ZnF_C2H2 269 291 2.84e-5 SMART
ZnF_C2H2 296 318 1.03e-2 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 4.24e-4 SMART
ZnF_C2H2 380 402 4.79e-3 SMART
ZnF_C2H2 408 430 1.06e-4 SMART
ZnF_C2H2 436 458 1.06e-4 SMART
ZnF_C2H2 464 486 3.95e-4 SMART
ZnF_C2H2 492 514 1.15e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082758
Predicted Effect probably benign
Transcript: ENSMUST00000108705
SMART Domains Protein: ENSMUSP00000104345
Gene: ENSMUSG00000047342

DomainStartEndE-ValueType
KRAB 50 114 1.2e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152602
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,217,457 (GRCm39) D133G probably damaging Het
Abcg4 G T 9: 44,190,616 (GRCm39) H55Q probably damaging Het
Acaca T A 11: 84,142,116 (GRCm39) V641E probably benign Het
Adam28 T C 14: 68,875,552 (GRCm39) I229V probably damaging Het
Adgrl3 T A 5: 81,837,493 (GRCm39) I793N probably damaging Het
Akr1d1 A T 6: 37,535,336 (GRCm39) D240V possibly damaging Het
Arhgef25 T C 10: 127,018,802 (GRCm39) D548G probably benign Het
Asl A G 5: 130,042,802 (GRCm39) probably null Het
Atg14 C T 14: 47,788,771 (GRCm39) R194Q probably damaging Het
BC004004 T A 17: 29,501,166 (GRCm39) F38L probably damaging Het
Btg1 T C 10: 96,453,259 (GRCm39) F25L probably benign Het
Btrc C T 19: 45,445,026 (GRCm39) P35S probably benign Het
Calcr T A 6: 3,714,705 (GRCm39) N142Y probably damaging Het
Ccdc138 A G 10: 58,397,818 (GRCm39) I553V probably benign Het
Ccdc198 T A 14: 49,482,560 (GRCm39) N52I probably damaging Het
Cdc42 T A 4: 137,056,115 (GRCm39) N132I probably benign Het
Ces1e A G 8: 93,950,716 (GRCm39) S22P probably benign Het
Clmn G T 12: 104,748,307 (GRCm39) D413E probably benign Het
Cramp1 T C 17: 25,201,293 (GRCm39) T730A probably benign Het
Dnah5 A T 15: 28,343,784 (GRCm39) M2395L probably benign Het
Ephx1 G T 1: 180,829,488 (GRCm39) S20Y possibly damaging Het
Exoc5 T G 14: 49,289,821 (GRCm39) E19A probably damaging Het
Fam120b T C 17: 15,623,294 (GRCm39) L424P probably benign Het
Fam89a G A 8: 125,467,823 (GRCm39) T163I possibly damaging Het
Fcrl2 G A 3: 87,166,922 (GRCm39) L24F possibly damaging Het
Fgd6 G T 10: 93,975,715 (GRCm39) V1377L probably benign Het
Glud1 T A 14: 34,057,347 (GRCm39) I337K possibly damaging Het
Gm6370 T A 5: 146,430,736 (GRCm39) I303N probably benign Het
Gm7995 T C 14: 42,133,383 (GRCm39) Y88H probably damaging Het
Gsdma3 T C 11: 98,520,393 (GRCm39) probably null Het
Gsdmc2 T C 15: 63,707,614 (GRCm39) D60G probably damaging Het
Hcn1 T A 13: 118,039,431 (GRCm39) probably null Het
Hectd1 A T 12: 51,831,030 (GRCm39) C936* probably null Het
Herc4 T A 10: 63,121,433 (GRCm39) S358T probably benign Het
Hk3 A G 13: 55,158,735 (GRCm39) C515R probably benign Het
Ighg1 A G 12: 113,291,138 (GRCm39) probably benign Het
Iqgap3 T A 3: 88,014,842 (GRCm39) C853S probably benign Het
Irx4 G A 13: 73,415,750 (GRCm39) A180T probably damaging Het
Kif20b A G 19: 34,943,522 (GRCm39) T1441A probably benign Het
Lifr A G 15: 7,215,106 (GRCm39) K738E possibly damaging Het
Lmntd2 A T 7: 140,792,531 (GRCm39) S218T probably damaging Het
Lnx1 A T 5: 74,768,530 (GRCm39) W353R probably benign Het
Lrfn3 G T 7: 30,055,238 (GRCm39) P569Q possibly damaging Het
Mamstr A G 7: 45,293,838 (GRCm39) I11V probably benign Het
Med31 T C 11: 72,104,975 (GRCm39) N32S possibly damaging Het
Mob3c A T 4: 115,690,928 (GRCm39) I173F probably benign Het
Morc3 A G 16: 93,667,250 (GRCm39) probably null Het
Mphosph9 T C 5: 124,437,108 (GRCm39) K412R probably damaging Het
Mtcl3 A T 10: 29,072,537 (GRCm39) N610Y probably damaging Het
Mthfd1l C T 10: 3,957,775 (GRCm39) P271S probably benign Het
Ncam1 C T 9: 49,453,183 (GRCm39) probably null Het
Ncbp3 T A 11: 72,960,578 (GRCm39) Y279N probably damaging Het
Ncoa6 G A 2: 155,248,687 (GRCm39) T1539I probably benign Het
Nedd4 G A 9: 72,647,515 (GRCm39) probably null Het
Neil1 A G 9: 57,054,206 (GRCm39) V38A probably damaging Het
Ngf T A 3: 102,427,961 (GRCm39) F237I probably damaging Het
Nol3 A G 8: 106,005,888 (GRCm39) Q94R possibly damaging Het
Obox1 A G 7: 15,290,263 (GRCm39) N202S probably damaging Het
Odc1 T A 12: 17,597,386 (GRCm39) N29K possibly damaging Het
Or2b7 C T 13: 21,739,658 (GRCm39) R178H probably benign Het
Or2h15 T C 17: 38,441,508 (GRCm39) T192A probably damaging Het
Or4a69 C T 2: 89,312,652 (GRCm39) V276I probably benign Het
Or52a20 A C 7: 103,365,914 (GRCm39) I38L probably benign Het
P2rx7 T A 5: 122,819,129 (GRCm39) V517E probably damaging Het
Parm1 A G 5: 91,741,775 (GRCm39) T48A possibly damaging Het
Pcdh9 T A 14: 94,126,164 (GRCm39) D2V possibly damaging Het
Pgm3 G T 9: 86,451,378 (GRCm39) T92N probably damaging Het
Plcg2 G T 8: 118,333,872 (GRCm39) G882* probably null Het
Ptpn14 C T 1: 189,582,997 (GRCm39) P615S probably damaging Het
Ptprk A T 10: 28,464,928 (GRCm39) Y1244F probably damaging Het
Rere G A 4: 150,700,510 (GRCm39) A1162T probably damaging Het
Rfx2 T C 17: 57,090,747 (GRCm39) E391G probably damaging Het
Sema4c A G 1: 36,591,097 (GRCm39) V414A probably damaging Het
Serpinb10 A T 1: 107,468,681 (GRCm39) N185I probably damaging Het
Shroom3 T G 5: 93,098,993 (GRCm39) M1410R probably benign Het
Slc13a1 A T 6: 24,134,356 (GRCm39) S176T probably benign Het
Sntb1 A T 15: 55,506,198 (GRCm39) Y458* probably null Het
Sorcs1 C T 19: 50,220,741 (GRCm39) V570I probably benign Het
Sp8 T A 12: 118,812,805 (GRCm39) V220E probably damaging Het
Spry1 C T 3: 37,696,868 (GRCm39) T37M possibly damaging Het
Sspo A T 6: 48,437,756 (GRCm39) H1305L probably benign Het
Tbc1d22a A G 15: 86,381,117 (GRCm39) D509G possibly damaging Het
Tmem108 A T 9: 103,376,276 (GRCm39) V391D possibly damaging Het
Tmem132d T A 5: 128,346,366 (GRCm39) H52L possibly damaging Het
Tmem132d T A 5: 128,346,364 (GRCm39) I53F probably damaging Het
Tnnt2 A T 1: 135,775,496 (GRCm39) R87* probably null Het
Ube3a A T 7: 58,893,198 (GRCm39) M1L probably benign Het
Unc79 A G 12: 103,060,592 (GRCm39) T1119A probably damaging Het
Usf3 A T 16: 44,039,942 (GRCm39) H1474L probably damaging Het
Vcpip1 G A 1: 9,817,423 (GRCm39) T320I probably damaging Het
Vmn1r56 A G 7: 5,199,443 (GRCm39) L58P probably damaging Het
Wdr53 A T 16: 32,075,796 (GRCm39) K334* probably null Het
Zbtb40 T A 4: 136,728,241 (GRCm39) R459W probably benign Het
Zfc3h1 T A 10: 115,246,547 (GRCm39) L878Q probably damaging Het
Zfp46 T A 4: 136,017,792 (GRCm39) C209S probably damaging Het
Zup1 G T 10: 33,825,038 (GRCm39) T148K probably damaging Het
Other mutations in Zfp286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02659:Zfp286 APN 11 62,674,563 (GRCm39) missense possibly damaging 0.54
IGL02745:Zfp286 APN 11 62,671,700 (GRCm39) missense probably damaging 1.00
IGL02826:Zfp286 APN 11 62,678,786 (GRCm39) missense probably damaging 0.99
R0233:Zfp286 UTSW 11 62,671,219 (GRCm39) missense possibly damaging 0.75
R0233:Zfp286 UTSW 11 62,671,219 (GRCm39) missense possibly damaging 0.75
R0318:Zfp286 UTSW 11 62,675,788 (GRCm39) missense probably damaging 1.00
R1954:Zfp286 UTSW 11 62,674,534 (GRCm39) missense possibly damaging 0.46
R1994:Zfp286 UTSW 11 62,670,646 (GRCm39) missense probably damaging 1.00
R2186:Zfp286 UTSW 11 62,671,287 (GRCm39) missense probably damaging 0.97
R4258:Zfp286 UTSW 11 62,671,896 (GRCm39) missense probably benign 0.07
R4327:Zfp286 UTSW 11 62,670,844 (GRCm39) missense probably damaging 1.00
R4453:Zfp286 UTSW 11 62,671,030 (GRCm39) missense probably damaging 1.00
R4479:Zfp286 UTSW 11 62,671,030 (GRCm39) missense probably damaging 1.00
R4647:Zfp286 UTSW 11 62,674,559 (GRCm39) nonsense probably null
R4667:Zfp286 UTSW 11 62,671,428 (GRCm39) missense probably benign 0.00
R4978:Zfp286 UTSW 11 62,679,754 (GRCm39) critical splice donor site probably null
R5120:Zfp286 UTSW 11 62,671,551 (GRCm39) missense probably benign 0.40
R5533:Zfp286 UTSW 11 62,671,796 (GRCm39) intron probably benign
R7236:Zfp286 UTSW 11 62,674,496 (GRCm39) critical splice donor site probably null
R7464:Zfp286 UTSW 11 62,671,627 (GRCm39) missense probably benign 0.00
R8065:Zfp286 UTSW 11 62,644,345 (GRCm39) missense unknown
R8067:Zfp286 UTSW 11 62,644,345 (GRCm39) missense unknown
R8716:Zfp286 UTSW 11 62,671,817 (GRCm39) missense unknown
R9351:Zfp286 UTSW 11 62,670,801 (GRCm39) missense probably damaging 0.97
Z1186:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1186:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1187:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1187:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1188:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1188:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1189:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1189:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1190:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1190:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1191:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1191:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Z1192:Zfp286 UTSW 11 62,678,795 (GRCm39) missense probably benign
Z1192:Zfp286 UTSW 11 62,675,782 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAAGAGATGAGCAGTGGC -3'
(R):5'- CCGACATTGAAACTGCTCTTG -3'

Sequencing Primer
(F):5'- CTCTGATGTACCTCAAGGGATGAAC -3'
(R):5'- CGACATTGAAACTGCTCTTGAATGTG -3'
Posted On 2016-03-17