Mutagenetix > Incidental Mutation

Incidental Mutation 'R4883:Dnah5'

375463

Institutional Source

Beutler Lab

Gene Symbol

Dnah5

Ensembl Gene

ENSMUSG00000022262

Gene Name

dynein, axonemal, heavy chain 5

Synonyms

b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5

MMRRC Submission

042491-MU

Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R4883 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28203752-28472052 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28343638 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 2395 (M2395L)

Ref Sequence

ENSEMBL: ENSMUSP00000069751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067048]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067048
AA Change: M2395L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: M2395L

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	247	802	2.3e-163	PFAM
low complexity region	1077	1088	N/A	INTRINSIC
low complexity region	1113	1128	N/A	INTRINSIC
Pfam:DHC_N2	1399	1807	2.3e-134	PFAM
AAA	1972	2108	2e-3	SMART
AAA	2251	2424	4.3e-3	SMART
AAA	2579	2777	2.2e-3	SMART
low complexity region	2874	2889	N/A	INTRINSIC
Pfam:AAA_8	2914	3186	3.2e-70	PFAM
Pfam:MT	3198	3546	1e-44	PFAM
Pfam:AAA_9	3567	3792	1.4e-86	PFAM
low complexity region	3889	3899	N/A	INTRINSIC
Pfam:Dynein_heavy	3930	4618	4.4e-246	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	T	A	14: 49,245,103	N52I	probably damaging	Het
Abca5	T	C	11: 110,326,631	D133G	probably damaging	Het
Abcg4	G	T	9: 44,279,319	H55Q	probably damaging	Het
Acaca	T	A	11: 84,251,290	V641E	probably benign	Het
Adam28	T	C	14: 68,638,103	I229V	probably damaging	Het
Adgrl3	T	A	5: 81,689,646	I793N	probably damaging	Het
Akr1d1	A	T	6: 37,558,401	D240V	possibly damaging	Het
Arhgef25	T	C	10: 127,182,933	D548G	probably benign	Het
Asl	A	G	5: 130,013,961		probably null	Het
Atg14	C	T	14: 47,551,314	R194Q	probably damaging	Het
BC004004	T	A	17: 29,282,192	F38L	probably damaging	Het
Btg1	T	C	10: 96,617,397	F25L	probably benign	Het
Btrc	C	T	19: 45,456,587	P35S	probably benign	Het
Calcr	T	A	6: 3,714,705	N142Y	probably damaging	Het
Ccdc138	A	G	10: 58,561,996	I553V	probably benign	Het
Cdc42	T	A	4: 137,328,804	N132I	probably benign	Het
Ces1e	A	G	8: 93,224,088	S22P	probably benign	Het
Clmn	G	T	12: 104,782,048	D413E	probably benign	Het
Cramp1l	T	C	17: 24,982,319	T730A	probably benign	Het
Ephx1	G	T	1: 181,001,923	S20Y	possibly damaging	Het
Exoc5	T	G	14: 49,052,364	E19A	probably damaging	Het
Fam120b	T	C	17: 15,403,032	L424P	probably benign	Het
Fam89a	G	A	8: 124,741,084	T163I	possibly damaging	Het
Fcrls	G	A	3: 87,259,615	L24F	possibly damaging	Het
Fgd6	G	T	10: 94,139,853	V1377L	probably benign	Het
Glud1	T	A	14: 34,335,390	I337K	possibly damaging	Het
Gm6370	T	A	5: 146,493,926	I303N	probably benign	Het
Gm7995	T	C	14: 42,311,426	Y88H	probably damaging	Het
Gsdma3	T	C	11: 98,629,567		probably null	Het
Gsdmc2	T	C	15: 63,835,765	D60G	probably damaging	Het
Hcn1	T	A	13: 117,902,895		probably null	Het
Hectd1	A	T	12: 51,784,247	C936*	probably null	Het
Herc4	T	A	10: 63,285,654	S358T	probably benign	Het
Hk3	A	G	13: 55,010,922	C515R	probably benign	Het
Ighg1	A	G	12: 113,327,518		probably benign	Het
Iqgap3	T	A	3: 88,107,535	C853S	probably benign	Het
Irx4	G	A	13: 73,267,631	A180T	probably damaging	Het
Kif20b	A	G	19: 34,966,122	T1441A	probably benign	Het
Lifr	A	G	15: 7,185,625	K738E	possibly damaging	Het
Lmntd2	A	T	7: 141,212,618	S218T	probably damaging	Het
Lnx1	A	T	5: 74,607,869	W353R	probably benign	Het
Lrfn3	G	T	7: 30,355,813	P569Q	possibly damaging	Het
Mamstr	A	G	7: 45,644,414	I11V	probably benign	Het
Med31	T	C	11: 72,214,149	N32S	possibly damaging	Het
Mob3c	A	T	4: 115,833,731	I173F	probably benign	Het
Morc3	A	G	16: 93,870,362		probably null	Het
Mphosph9	T	C	5: 124,299,045	K412R	probably damaging	Het
Mthfd1l	C	T	10: 4,007,775	P271S	probably benign	Het
Ncam1	C	T	9: 49,541,883		probably null	Het
Ncbp3	T	A	11: 73,069,752	Y279N	probably damaging	Het
Ncoa6	G	A	2: 155,406,767	T1539I	probably benign	Het
Nedd4	G	A	9: 72,740,233		probably null	Het
Neil1	A	G	9: 57,146,922	V38A	probably damaging	Het
Ngf	T	A	3: 102,520,645	F237I	probably damaging	Het
Nol3	A	G	8: 105,279,256	Q94R	possibly damaging	Het
Obox1	A	G	7: 15,556,338	N202S	probably damaging	Het
Odc1	T	A	12: 17,547,385	N29K	possibly damaging	Het
Olfr1241	C	T	2: 89,482,308	V276I	probably benign	Het
Olfr132	T	C	17: 38,130,617	T192A	probably damaging	Het
Olfr1535	C	T	13: 21,555,488	R178H	probably benign	Het
Olfr243	A	C	7: 103,716,707	I38L	probably benign	Het
P2rx7	T	A	5: 122,681,066	V517E	probably damaging	Het
Parm1	A	G	5: 91,593,916	T48A	possibly damaging	Het
Pcdh9	T	A	14: 93,888,728	D2V	possibly damaging	Het
Pgm3	G	T	9: 86,569,325	T92N	probably damaging	Het
Plcg2	G	T	8: 117,607,133	G882*	probably null	Het
Ptpn14	C	T	1: 189,850,800	P615S	probably damaging	Het
Ptprk	A	T	10: 28,588,932	Y1244F	probably damaging	Het
Rere	G	A	4: 150,616,053	A1162T	probably damaging	Het
Rfx2	T	C	17: 56,783,747	E391G	probably damaging	Het
Sema4c	A	G	1: 36,552,016	V414A	probably damaging	Het
Serpinb10	A	T	1: 107,540,951	N185I	probably damaging	Het
Shroom3	T	G	5: 92,951,134	M1410R	probably benign	Het
Slc13a1	A	T	6: 24,134,357	S176T	probably benign	Het
Sntb1	A	T	15: 55,642,802	Y458*	probably null	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Sorcs1	C	T	19: 50,232,303	V570I	probably benign	Het
Sp8	T	A	12: 118,849,070	V220E	probably damaging	Het
Spry1	C	T	3: 37,642,719	T37M	possibly damaging	Het
Sspo	A	T	6: 48,460,822	H1305L	probably benign	Het
Tbc1d22a	A	G	15: 86,496,916	D509G	possibly damaging	Het
Tmem108	A	T	9: 103,499,077	V391D	possibly damaging	Het
Tmem132d	T	A	5: 128,269,300	I53F	probably damaging	Het
Tmem132d	T	A	5: 128,269,302	H52L	possibly damaging	Het
Tnnt2	A	T	1: 135,847,758	R87*	probably null	Het
Ube3a	A	T	7: 59,243,450	M1L	probably benign	Het
Unc79	A	G	12: 103,094,333	T1119A	probably damaging	Het
Usf3	A	T	16: 44,219,579	H1474L	probably damaging	Het
Vcpip1	G	A	1: 9,747,198	T320I	probably damaging	Het
Vmn1r56	A	G	7: 5,196,444	L58P	probably damaging	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Zbtb40	T	A	4: 137,000,930	R459W	probably benign	Het
Zfc3h1	T	A	10: 115,410,642	L878Q	probably damaging	Het
Zfp286	T	C	11: 62,780,629	D206G	probably benign	Het
Zfp46	T	A	4: 136,290,481	C209S	probably damaging	Het
Zufsp	G	T	10: 33,949,042	T148K	probably damaging	Het

Other mutations in Dnah5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dnah5	APN	15	28272342	missense	probably benign
IGL00331:Dnah5	APN	15	28421620	missense	probably damaging	1.00
IGL00519:Dnah5	APN	15	28444218	missense	probably benign	0.10
IGL00537:Dnah5	APN	15	28458702	critical splice donor site	probably null
IGL01102:Dnah5	APN	15	28410003	critical splice donor site	probably null
IGL01126:Dnah5	APN	15	28302399	missense	possibly damaging	0.85
IGL01154:Dnah5	APN	15	28458656	missense	possibly damaging	0.75
IGL01349:Dnah5	APN	15	28294913	splice site	probably benign
IGL01353:Dnah5	APN	15	28233272	missense	probably benign	0.00
IGL01372:Dnah5	APN	15	28230490	missense	probably benign	0.00
IGL01390:Dnah5	APN	15	28411540	missense	probably benign	0.00
IGL01446:Dnah5	APN	15	28326669	missense	probably damaging	1.00
IGL01472:Dnah5	APN	15	28331726	missense	probably damaging	1.00
IGL01485:Dnah5	APN	15	28331726	missense	probably damaging	1.00
IGL01568:Dnah5	APN	15	28229652	missense	probably benign	0.01
IGL01592:Dnah5	APN	15	28236637	missense	probably benign	0.01
IGL01594:Dnah5	APN	15	28311334	missense	possibly damaging	0.87
IGL01677:Dnah5	APN	15	28367782	missense	probably damaging	1.00
IGL01845:Dnah5	APN	15	28449169	missense	probably benign	0.06
IGL01904:Dnah5	APN	15	28307364	missense	probably benign	0.09
IGL01913:Dnah5	APN	15	28313753	missense	possibly damaging	0.50
IGL01950:Dnah5	APN	15	28290289	missense	probably null	1.00
IGL01963:Dnah5	APN	15	28370536	missense	probably benign	0.12
IGL02008:Dnah5	APN	15	28343552	missense	probably damaging	0.98
IGL02088:Dnah5	APN	15	28459118	critical splice acceptor site	probably null
IGL02090:Dnah5	APN	15	28240041	splice site	probably benign
IGL02114:Dnah5	APN	15	28397124	missense	probably damaging	0.97
IGL02135:Dnah5	APN	15	28247885	missense	possibly damaging	0.50
IGL02232:Dnah5	APN	15	28299240	missense	probably damaging	1.00
IGL02386:Dnah5	APN	15	28340381	missense	probably damaging	1.00
IGL02475:Dnah5	APN	15	28219150	missense	probably benign	0.09
IGL02626:Dnah5	APN	15	28307276	missense	possibly damaging	0.94
IGL02650:Dnah5	APN	15	28289047	splice site	probably benign
IGL02651:Dnah5	APN	15	28350622	missense	probably benign	0.05
IGL02652:Dnah5	APN	15	28366187	missense	probably damaging	0.99
IGL02670:Dnah5	APN	15	28409296	missense	probably damaging	1.00
IGL02697:Dnah5	APN	15	28445143	missense	probably benign	0.00
IGL02721:Dnah5	APN	15	28234243	critical splice acceptor site	probably null
IGL02858:Dnah5	APN	15	28453212	missense	possibly damaging	0.65
IGL02859:Dnah5	APN	15	28383625	missense	probably benign	0.01
IGL02945:Dnah5	APN	15	28270426	missense	probably benign	0.00
IGL02949:Dnah5	APN	15	28272185	missense	probably benign	0.32
IGL02971:Dnah5	APN	15	28384461	missense	probably damaging	1.00
IGL03017:Dnah5	APN	15	28340325	missense	possibly damaging	0.93
IGL03177:Dnah5	APN	15	28295399	missense	probably damaging	0.97
IGL03212:Dnah5	APN	15	28290163	missense	probably benign	0.08
IGL03224:Dnah5	APN	15	28459154	missense	probably damaging	1.00
IGL03231:Dnah5	APN	15	28311148	missense	probably damaging	1.00
IGL03273:Dnah5	APN	15	28458649	missense	probably damaging	0.98
IGL03294:Dnah5	APN	15	28233295	critical splice donor site	probably null
IGL03331:Dnah5	APN	15	28419940	missense	probably damaging	1.00
IGL03337:Dnah5	APN	15	28290141	missense	probably benign	0.10
IGL03367:Dnah5	APN	15	28234327	missense	possibly damaging	0.95
Firtel	UTSW	15	28448367	missense	possibly damaging	0.95
lowbar	UTSW	15	28311133	splice site	probably null
notherone	UTSW	15	28340406	missense	probably benign	0.13
scheffler	UTSW	15	28438091	splice site	probably benign
IGL02837:Dnah5	UTSW	15	28269400	missense	probably benign
P0008:Dnah5	UTSW	15	28302387	missense	probably damaging	1.00
P0014:Dnah5	UTSW	15	28403473	missense	probably damaging	1.00
PIT4687001:Dnah5	UTSW	15	28383577	missense	probably damaging	0.98
R0030:Dnah5	UTSW	15	28451517	missense	probably benign	0.34
R0087:Dnah5	UTSW	15	28350613	missense	probably damaging	1.00
R0099:Dnah5	UTSW	15	28239934	missense	probably damaging	1.00
R0102:Dnah5	UTSW	15	28245751	splice site	probably benign
R0102:Dnah5	UTSW	15	28245751	splice site	probably benign
R0104:Dnah5	UTSW	15	28453353	missense	possibly damaging	0.88
R0112:Dnah5	UTSW	15	28263679	missense	probably benign	0.00
R0122:Dnah5	UTSW	15	28378363	missense	probably damaging	1.00
R0126:Dnah5	UTSW	15	28246319	missense	probably benign	0.00
R0127:Dnah5	UTSW	15	28294925	missense	probably damaging	1.00
R0233:Dnah5	UTSW	15	28333070	missense	probably damaging	1.00
R0310:Dnah5	UTSW	15	28299110	missense	probably benign	0.19
R0386:Dnah5	UTSW	15	28383581	missense	probably damaging	1.00
R0421:Dnah5	UTSW	15	28229541	missense	possibly damaging	0.79
R0481:Dnah5	UTSW	15	28383599	missense	probably benign	0.31
R0514:Dnah5	UTSW	15	28366321	missense	probably damaging	1.00
R0609:Dnah5	UTSW	15	28327779	missense	probably benign
R0720:Dnah5	UTSW	15	28313861	missense	probably null	0.98
R0731:Dnah5	UTSW	15	28311143	missense	possibly damaging	0.78
R0747:Dnah5	UTSW	15	28444186	missense	probably damaging	0.99
R0747:Dnah5	UTSW	15	28444187	missense	possibly damaging	0.64
R0766:Dnah5	UTSW	15	28448487	missense	probably null	0.89
R0849:Dnah5	UTSW	15	28263599	missense	probably damaging	0.96
R1034:Dnah5	UTSW	15	28302471	missense	probably damaging	1.00
R1084:Dnah5	UTSW	15	28343452	missense	probably benign	0.01
R1148:Dnah5	UTSW	15	28421690	missense	probably damaging	1.00
R1148:Dnah5	UTSW	15	28421690	missense	probably damaging	1.00
R1200:Dnah5	UTSW	15	28246257	missense	possibly damaging	0.88
R1208:Dnah5	UTSW	15	28327731	missense	probably damaging	1.00
R1208:Dnah5	UTSW	15	28327731	missense	probably damaging	1.00
R1269:Dnah5	UTSW	15	28238511	missense	probably damaging	1.00
R1373:Dnah5	UTSW	15	28313918	splice site	probably benign
R1401:Dnah5	UTSW	15	28401913	missense	probably damaging	1.00
R1413:Dnah5	UTSW	15	28370409	missense	probably benign
R1430:Dnah5	UTSW	15	28345857	missense	probably benign	0.37
R1457:Dnah5	UTSW	15	28403542	critical splice donor site	probably null
R1468:Dnah5	UTSW	15	28230463	nonsense	probably null
R1468:Dnah5	UTSW	15	28230463	nonsense	probably null
R1560:Dnah5	UTSW	15	28420003	missense	probably damaging	1.00
R1568:Dnah5	UTSW	15	28409177	missense	probably damaging	0.98
R1574:Dnah5	UTSW	15	28252423	missense	probably benign	0.00
R1574:Dnah5	UTSW	15	28252423	missense	probably benign	0.00
R1603:Dnah5	UTSW	15	28294985	splice site	probably benign
R1603:Dnah5	UTSW	15	28449180	missense	probably benign	0.09
R1673:Dnah5	UTSW	15	28290148	missense	probably benign
R1755:Dnah5	UTSW	15	28326636	missense	probably damaging	0.99
R1785:Dnah5	UTSW	15	28313786	missense	probably damaging	1.00
R1786:Dnah5	UTSW	15	28313786	missense	probably damaging	1.00
R1789:Dnah5	UTSW	15	28270426	missense	probably benign	0.00
R1817:Dnah5	UTSW	15	28246400	nonsense	probably null
R1819:Dnah5	UTSW	15	28246400	nonsense	probably null
R1834:Dnah5	UTSW	15	28409124	missense	probably benign	0.00
R1855:Dnah5	UTSW	15	28411669	missense	possibly damaging	0.88
R1870:Dnah5	UTSW	15	28331713	nonsense	probably null
R1871:Dnah5	UTSW	15	28331713	nonsense	probably null
R1987:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R1988:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R1989:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R2062:Dnah5	UTSW	15	28366270	missense	probably damaging	1.00
R2069:Dnah5	UTSW	15	28312388	splice site	probably null
R2121:Dnah5	UTSW	15	28297005	splice site	probably benign
R2128:Dnah5	UTSW	15	28408321	missense	probably benign	0.00
R2129:Dnah5	UTSW	15	28408321	missense	probably benign	0.00
R2151:Dnah5	UTSW	15	28444091	missense	probably damaging	1.00
R2159:Dnah5	UTSW	15	28252545	missense	probably benign	0.00
R2207:Dnah5	UTSW	15	28343671	missense	probably benign	0.11
R2231:Dnah5	UTSW	15	28408417	critical splice donor site	probably null
R2232:Dnah5	UTSW	15	28408417	critical splice donor site	probably null
R2282:Dnah5	UTSW	15	28327302	missense	probably damaging	0.99
R2305:Dnah5	UTSW	15	28387767	missense	probably benign	0.25
R2339:Dnah5	UTSW	15	28313882	missense	probably benign	0.00
R2437:Dnah5	UTSW	15	28307391	critical splice donor site	probably null
R2696:Dnah5	UTSW	15	28278576	missense	probably benign	0.00
R3156:Dnah5	UTSW	15	28438091	splice site	probably benign
R3431:Dnah5	UTSW	15	28295267	missense	probably benign	0.20
R3700:Dnah5	UTSW	15	28387791	missense	possibly damaging	0.72
R3724:Dnah5	UTSW	15	28270420	missense	probably benign	0.08
R3732:Dnah5	UTSW	15	28409122	missense	possibly damaging	0.64
R3872:Dnah5	UTSW	15	28411510	missense	possibly damaging	0.50
R4063:Dnah5	UTSW	15	28420998	missense	probably damaging	0.98
R4072:Dnah5	UTSW	15	28340298	nonsense	probably null
R4075:Dnah5	UTSW	15	28293791	missense	probably benign
R4245:Dnah5	UTSW	15	28219189	missense	probably benign
R4254:Dnah5	UTSW	15	28438102	missense	probably benign	0.07
R4255:Dnah5	UTSW	15	28438102	missense	probably benign	0.07
R4392:Dnah5	UTSW	15	28289229	missense	probably benign	0.19
R4552:Dnah5	UTSW	15	28397154	missense	probably benign	0.19
R4574:Dnah5	UTSW	15	28367763	missense	probably benign	0.05
R4577:Dnah5	UTSW	15	28289250	missense	probably benign	0.06
R4587:Dnah5	UTSW	15	28304599	missense	probably damaging	1.00
R4631:Dnah5	UTSW	15	28401953	missense	probably damaging	1.00
R4631:Dnah5	UTSW	15	28419994	missense	probably damaging	1.00
R4676:Dnah5	UTSW	15	28295260	missense	possibly damaging	0.65
R4707:Dnah5	UTSW	15	28372375	missense	probably damaging	0.97
R4754:Dnah5	UTSW	15	28420955	splice site	probably null
R4767:Dnah5	UTSW	15	28270474	missense	probably benign	0.02
R4857:Dnah5	UTSW	15	28345807	missense	probably benign	0.00
R4889:Dnah5	UTSW	15	28235792	missense	probably benign	0.01
R4946:Dnah5	UTSW	15	28326557	missense	probably damaging	0.96
R4946:Dnah5	UTSW	15	28387904	missense	probably damaging	1.00
R4947:Dnah5	UTSW	15	28272372	missense	probably benign
R5033:Dnah5	UTSW	15	28421678	missense	probably damaging	0.96
R5164:Dnah5	UTSW	15	28408292	missense	probably benign	0.00
R5175:Dnah5	UTSW	15	28448404	missense	probably damaging	1.00
R5182:Dnah5	UTSW	15	28311278	missense	probably damaging	0.99
R5187:Dnah5	UTSW	15	28272172	missense	probably benign	0.41
R5272:Dnah5	UTSW	15	28350665	missense	probably benign
R5308:Dnah5	UTSW	15	28229651	missense	possibly damaging	0.80
R5310:Dnah5	UTSW	15	28311328	missense	probably damaging	1.00
R5322:Dnah5	UTSW	15	28384244	missense	probably benign	0.41
R5398:Dnah5	UTSW	15	28293726	missense	probably benign
R5596:Dnah5	UTSW	15	28343608	missense	probably damaging	1.00
R5603:Dnah5	UTSW	15	28419932	missense	probably damaging	1.00
R5619:Dnah5	UTSW	15	28302435	missense	probably damaging	1.00
R5656:Dnah5	UTSW	15	28421064	missense	probably benign	0.03
R5741:Dnah5	UTSW	15	28246367	missense	probably benign	0.11
R5754:Dnah5	UTSW	15	28401868	missense	probably benign	0.01
R5763:Dnah5	UTSW	15	28311152	missense	probably damaging	1.00
R5824:Dnah5	UTSW	15	28313821	missense	probably benign	0.00
R5836:Dnah5	UTSW	15	28383592	missense	probably damaging	1.00
R5838:Dnah5	UTSW	15	28290195	missense	probably benign	0.00
R5864:Dnah5	UTSW	15	28297013	missense	possibly damaging	0.83
R5895:Dnah5	UTSW	15	28234453	splice site	probably null
R5896:Dnah5	UTSW	15	28272060	missense	probably benign
R5899:Dnah5	UTSW	15	28448367	missense	possibly damaging	0.95
R5905:Dnah5	UTSW	15	28387833	missense	probably damaging	1.00
R5924:Dnah5	UTSW	15	28307327	missense	probably benign	0.41
R5927:Dnah5	UTSW	15	28335718	missense	probably benign	0.00
R5929:Dnah5	UTSW	15	28311207	missense	probably benign	0.01
R5929:Dnah5	UTSW	15	28311208	missense	probably damaging	1.00
R5931:Dnah5	UTSW	15	28453279	missense	probably damaging	0.99
R5964:Dnah5	UTSW	15	28458584	missense	possibly damaging	0.49
R5975:Dnah5	UTSW	15	28234282	missense	probably damaging	1.00
R5993:Dnah5	UTSW	15	28299226	missense	probably benign	0.09
R6016:Dnah5	UTSW	15	28327884	missense	probably damaging	1.00
R6028:Dnah5	UTSW	15	28387833	missense	probably damaging	1.00
R6065:Dnah5	UTSW	15	28230468	missense	possibly damaging	0.47
R6117:Dnah5	UTSW	15	28270420	missense	probably damaging	0.99
R6143:Dnah5	UTSW	15	28233231	missense	probably benign	0.05
R6146:Dnah5	UTSW	15	28459185	missense	probably benign
R6154:Dnah5	UTSW	15	28204031	missense	probably benign	0.15
R6164:Dnah5	UTSW	15	28378343	missense	probably benign	0.08
R6266:Dnah5	UTSW	15	28335627	missense	possibly damaging	0.67
R6321:Dnah5	UTSW	15	28372411	missense	probably damaging	0.99
R6349:Dnah5	UTSW	15	28238511	missense	probably damaging	1.00
R6431:Dnah5	UTSW	15	28349824	missense	possibly damaging	0.52
R6467:Dnah5	UTSW	15	28438183	missense	probably benign	0.10
R6564:Dnah5	UTSW	15	28367745	missense	probably benign
R6607:Dnah5	UTSW	15	28445200	missense	possibly damaging	0.95
R6619:Dnah5	UTSW	15	28409120	missense	probably benign	0.03
R6633:Dnah5	UTSW	15	28293787	missense	probably benign	0.27
R6647:Dnah5	UTSW	15	28403487	missense	probably benign	0.02
R6782:Dnah5	UTSW	15	28449156	missense	possibly damaging	0.89
R6797:Dnah5	UTSW	15	28233238	nonsense	probably null
R6797:Dnah5	UTSW	15	28451463	missense	probably damaging	1.00
R6831:Dnah5	UTSW	15	28411515	missense	possibly damaging	0.88
R6849:Dnah5	UTSW	15	28278624	missense	probably benign	0.14
R6871:Dnah5	UTSW	15	28229640	missense	probably benign	0.32
R6936:Dnah5	UTSW	15	28409268	missense	probably damaging	1.00
R6943:Dnah5	UTSW	15	28235720	missense	probably damaging	1.00
R7030:Dnah5	UTSW	15	28238592	missense	probably benign
R7030:Dnah5	UTSW	15	28333062	missense	probably benign	0.00
R7032:Dnah5	UTSW	15	28326650	missense	probably damaging	1.00
R7063:Dnah5	UTSW	15	28233248	missense	probably benign	0.00
R7094:Dnah5	UTSW	15	28453336	missense	probably damaging	0.98
R7097:Dnah5	UTSW	15	28453264	missense	probably benign	0.00
R7126:Dnah5	UTSW	15	28349837	missense	probably benign	0.03
R7153:Dnah5	UTSW	15	28365522	splice site	probably null
R7209:Dnah5	UTSW	15	28459225	missense	possibly damaging	0.71
R7276:Dnah5	UTSW	15	28367838	missense	probably damaging	1.00
R7320:Dnah5	UTSW	15	28270470	missense	probably null	0.33
R7350:Dnah5	UTSW	15	28235819	critical splice donor site	probably null
R7380:Dnah5	UTSW	15	28370378	missense	probably damaging	1.00
R7438:Dnah5	UTSW	15	28346952	missense	probably damaging	0.99
R7499:Dnah5	UTSW	15	28302450	missense	probably damaging	1.00
R7513:Dnah5	UTSW	15	28370415	missense	probably benign
R7519:Dnah5	UTSW	15	28390483	missense	probably damaging	0.98
R7524:Dnah5	UTSW	15	28297066	missense	possibly damaging	0.50
R7556:Dnah5	UTSW	15	28290243	missense	probably null	0.43
R7570:Dnah5	UTSW	15	28346952	missense	probably damaging	1.00
R7585:Dnah5	UTSW	15	28401868	missense	probably benign	0.09
R7642:Dnah5	UTSW	15	28247979	critical splice donor site	probably null
R7670:Dnah5	UTSW	15	28246232	splice site	probably null
R7763:Dnah5	UTSW	15	28313855	missense	probably damaging	1.00
R7821:Dnah5	UTSW	15	28411532	missense	possibly damaging	0.89
R7826:Dnah5	UTSW	15	28367812	missense	probably damaging	1.00
R7872:Dnah5	UTSW	15	28245684	missense	probably damaging	0.99
R7889:Dnah5	UTSW	15	28448414	nonsense	probably null
R7919:Dnah5	UTSW	15	28350596	missense	probably damaging	1.00
R7920:Dnah5	UTSW	15	28453222	missense	probably benign	0.00
R7936:Dnah5	UTSW	15	28345837	missense	possibly damaging	0.64
R7996:Dnah5	UTSW	15	28409177	missense	probably damaging	0.98
R8063:Dnah5	UTSW	15	28230583	missense	probably benign
R8084:Dnah5	UTSW	15	28387953	missense	probably damaging	1.00
R8105:Dnah5	UTSW	15	28372402	missense	probably benign
R8114:Dnah5	UTSW	15	28239976	missense	probably benign	0.01
R8142:Dnah5	UTSW	15	28384373	missense	probably benign	0.36
R8153:Dnah5	UTSW	15	28384430	missense	probably damaging	1.00
R8161:Dnah5	UTSW	15	28350704	missense	possibly damaging	0.79
R8174:Dnah5	UTSW	15	28311133	splice site	probably null
R8187:Dnah5	UTSW	15	28384209	missense	probably damaging	1.00
R8194:Dnah5	UTSW	15	28453268	missense	probably damaging	0.99
R8280:Dnah5	UTSW	15	28408392	missense	probably benign	0.01
R8291:Dnah5	UTSW	15	28263597	missense	probably benign	0.03
R8324:Dnah5	UTSW	15	28346865	missense	probably damaging	1.00
R8347:Dnah5	UTSW	15	28236666	missense	possibly damaging	0.90
R8356:Dnah5	UTSW	15	28444167	missense	probably benign	0.03
R8356:Dnah5	UTSW	15	28444323	missense	probably null	0.02
R8361:Dnah5	UTSW	15	28331810	missense	probably damaging	0.98
R8375:Dnah5	UTSW	15	28327343	missense	probably benign	0.00
R8474:Dnah5	UTSW	15	28247832	missense	probably benign	0.00
R8481:Dnah5	UTSW	15	28419795	missense	probably benign	0.00
R8494:Dnah5	UTSW	15	28345831	missense	probably benign	0.32
R8495:Dnah5	UTSW	15	28409268	missense	probably damaging	0.97
R8519:Dnah5	UTSW	15	28299099	missense	probably benign	0.07
R8683:Dnah5	UTSW	15	28289221	missense	probably benign	0.00
R8739:Dnah5	UTSW	15	28345860	missense	probably benign	0.01
R8752:Dnah5	UTSW	15	28290219	missense	probably benign	0.00
R8784:Dnah5	UTSW	15	28387951	missense	probably benign	0.16
R8813:Dnah5	UTSW	15	28229573	missense	probably damaging	1.00
R8862:Dnah5	UTSW	15	28459356	splice site	probably benign
R8873:Dnah5	UTSW	15	28219188	missense	probably benign
R8885:Dnah5	UTSW	15	28327740	missense	probably damaging	1.00
R8901:Dnah5	UTSW	15	28365569	missense	possibly damaging	0.76
R9025:Dnah5	UTSW	15	28409266	missense	probably damaging	1.00
R9037:Dnah5	UTSW	15	28247958	missense	probably benign	0.05
R9057:Dnah5	UTSW	15	28390868	missense	probably damaging	1.00
R9059:Dnah5	UTSW	15	28245666	missense	probably benign
R9065:Dnah5	UTSW	15	28293790	missense	probably benign	0.09
R9098:Dnah5	UTSW	15	28419961	missense
R9118:Dnah5	UTSW	15	28401848	frame shift	probably null
R9149:Dnah5	UTSW	15	28387768	missense	probably benign	0.00
R9184:Dnah5	UTSW	15	28340406	missense	probably benign	0.13
R9205:Dnah5	UTSW	15	28448334	missense	possibly damaging	0.88
R9297:Dnah5	UTSW	15	28203908	start gained	probably benign
R9302:Dnah5	UTSW	15	28239886	missense	probably benign	0.03
R9310:Dnah5	UTSW	15	28448433	missense	probably damaging	1.00
R9318:Dnah5	UTSW	15	28203908	start gained	probably benign
R9405:Dnah5	UTSW	15	28272160	missense	probably benign
R9424:Dnah5	UTSW	15	28272140	missense	probably benign	0.01
R9467:Dnah5	UTSW	15	28366147	missense	possibly damaging	0.94
R9469:Dnah5	UTSW	15	28421000	missense	probably benign	0.06
R9548:Dnah5	UTSW	15	28327879	missense	possibly damaging	0.79
R9564:Dnah5	UTSW	15	28290276	missense	probably benign	0.04
R9576:Dnah5	UTSW	15	28272140	missense	probably benign	0.01
R9593:Dnah5	UTSW	15	28236628	missense	probably benign
R9644:Dnah5	UTSW	15	28230504	missense	probably damaging	0.98
R9655:Dnah5	UTSW	15	28242754	missense	probably benign
R9657:Dnah5	UTSW	15	28409943	missense	probably damaging	1.00
R9704:Dnah5	UTSW	15	28247819	missense	probably benign	0.00
R9797:Dnah5	UTSW	15	28233170	missense	probably benign	0.34
RF009:Dnah5	UTSW	15	28204019	missense	probably benign	0.00
X0011:Dnah5	UTSW	15	28408381	missense	probably benign	0.16
X0018:Dnah5	UTSW	15	28269354	missense	probably benign	0.00
X0022:Dnah5	UTSW	15	28270411	missense	probably benign	0.01
X0023:Dnah5	UTSW	15	28384308	missense	probably damaging	0.99
X0028:Dnah5	UTSW	15	28470477	missense	probably damaging	1.00
Z1088:Dnah5	UTSW	15	28366357	missense	probably null	0.10
Z1088:Dnah5	UTSW	15	28384230	missense	probably damaging	1.00
Z1177:Dnah5	UTSW	15	28270354	missense	probably benign	0.32
Z1177:Dnah5	UTSW	15	28270403	missense	probably benign	0.00
Z1177:Dnah5	UTSW	15	28295311	missense	probably damaging	0.98
Z1177:Dnah5	UTSW	15	28387763	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CTTGTCTTGGGTGACATCCAG -3'
(R):5'- CGCACATACAAGGGCCTTTC -3'

Sequencing Primer
(F):5'- CATCCAGGGGAACATATCTGGATTG -3'
(R):5'- TACAAGGGCCTTTCAGAAACAG -3'

Posted On

2016-03-17