Incidental Mutation 'R4883:Dnah5'
ID375463
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Namedynein, axonemal, heavy chain 5
Synonymsb2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 042491-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location28203752-28472052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28343638 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 2395 (M2395L)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: M2395L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: M2395L

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Glud1 T A 14: 34,335,390 I337K possibly damaging Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Herc4 T A 10: 63,285,654 S358T probably benign Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lifr A G 15: 7,185,625 K738E possibly damaging Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Mthfd1l C T 10: 4,007,775 P271S probably benign Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sorcs1 C T 19: 50,232,303 V570I probably benign Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
Firtel UTSW 15 28448367 missense possibly damaging 0.95
lowbar UTSW 15 28311133 splice site probably null
scheffler UTSW 15 28438091 splice site probably benign
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 splice site probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7153:Dnah5 UTSW 15 28365522 splice site probably null
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
R7350:Dnah5 UTSW 15 28235819 critical splice donor site probably null
R7380:Dnah5 UTSW 15 28370378 missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28346952 missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28302450 missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28370415 missense probably benign
R7519:Dnah5 UTSW 15 28390483 missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28297066 missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28290243 missense probably null 0.43
R7570:Dnah5 UTSW 15 28346952 missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28401868 missense probably benign 0.09
R7642:Dnah5 UTSW 15 28247979 critical splice donor site probably null
R7670:Dnah5 UTSW 15 28246232 splice site probably null
R7763:Dnah5 UTSW 15 28313855 missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28411532 missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28367812 missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28245684 missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28448414 nonsense probably null
R7919:Dnah5 UTSW 15 28350596 missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28453222 missense probably benign 0.00
R7936:Dnah5 UTSW 15 28345837 missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28230583 missense probably benign
R8084:Dnah5 UTSW 15 28387953 missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28372402 missense probably benign
R8114:Dnah5 UTSW 15 28239976 missense probably benign 0.01
R8142:Dnah5 UTSW 15 28384373 missense probably benign 0.36
R8153:Dnah5 UTSW 15 28384430 missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28350704 missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28311133 splice site probably null
R8187:Dnah5 UTSW 15 28384209 missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28453268 missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28408392 missense probably benign 0.01
R8291:Dnah5 UTSW 15 28263597 missense probably benign 0.03
R8324:Dnah5 UTSW 15 28346865 missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28236666 missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28444167 missense probably benign 0.03
R8356:Dnah5 UTSW 15 28444323 missense probably null 0.02
R8361:Dnah5 UTSW 15 28331810 missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28327343 missense probably benign 0.00
R8474:Dnah5 UTSW 15 28247832 missense probably benign 0.00
R8481:Dnah5 UTSW 15 28419795 missense probably benign 0.00
R8494:Dnah5 UTSW 15 28345831 missense probably benign 0.32
R8495:Dnah5 UTSW 15 28409268 missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28299099 missense probably benign 0.07
R8683:Dnah5 UTSW 15 28289221 missense probably benign 0.00
R8739:Dnah5 UTSW 15 28345860 missense probably benign 0.01
R8752:Dnah5 UTSW 15 28290219 missense probably benign 0.00
R8784:Dnah5 UTSW 15 28387951 missense probably benign 0.16
R8813:Dnah5 UTSW 15 28229573 missense probably damaging 1.00
RF009:Dnah5 UTSW 15 28204019 missense probably benign 0.00
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28270354 missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28270403 missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28295311 missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28387763 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTTGTCTTGGGTGACATCCAG -3'
(R):5'- CGCACATACAAGGGCCTTTC -3'

Sequencing Primer
(F):5'- CATCCAGGGGAACATATCTGGATTG -3'
(R):5'- TACAAGGGCCTTTCAGAAACAG -3'
Posted On2016-03-17