Incidental Mutation 'R4883:Tbc1d22a'
ID 375466
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene Name TBC1 domain family, member 22a
Synonyms D15Ertd781e
MMRRC Submission 042491-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4883 (G1)
Quality Score 175
Status Not validated
Chromosome 15
Chromosomal Location 86098660-86382704 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86381117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 509 (D509G)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414]
AlphaFold Q8R5A6
Predicted Effect possibly damaging
Transcript: ENSMUST00000063414
AA Change: D509G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: D509G

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T C 11: 110,217,457 (GRCm39) D133G probably damaging Het
Abcg4 G T 9: 44,190,616 (GRCm39) H55Q probably damaging Het
Acaca T A 11: 84,142,116 (GRCm39) V641E probably benign Het
Adam28 T C 14: 68,875,552 (GRCm39) I229V probably damaging Het
Adgrl3 T A 5: 81,837,493 (GRCm39) I793N probably damaging Het
Akr1d1 A T 6: 37,535,336 (GRCm39) D240V possibly damaging Het
Arhgef25 T C 10: 127,018,802 (GRCm39) D548G probably benign Het
Asl A G 5: 130,042,802 (GRCm39) probably null Het
Atg14 C T 14: 47,788,771 (GRCm39) R194Q probably damaging Het
BC004004 T A 17: 29,501,166 (GRCm39) F38L probably damaging Het
Btg1 T C 10: 96,453,259 (GRCm39) F25L probably benign Het
Btrc C T 19: 45,445,026 (GRCm39) P35S probably benign Het
Calcr T A 6: 3,714,705 (GRCm39) N142Y probably damaging Het
Ccdc138 A G 10: 58,397,818 (GRCm39) I553V probably benign Het
Ccdc198 T A 14: 49,482,560 (GRCm39) N52I probably damaging Het
Cdc42 T A 4: 137,056,115 (GRCm39) N132I probably benign Het
Ces1e A G 8: 93,950,716 (GRCm39) S22P probably benign Het
Clmn G T 12: 104,748,307 (GRCm39) D413E probably benign Het
Cramp1 T C 17: 25,201,293 (GRCm39) T730A probably benign Het
Dnah5 A T 15: 28,343,784 (GRCm39) M2395L probably benign Het
Ephx1 G T 1: 180,829,488 (GRCm39) S20Y possibly damaging Het
Exoc5 T G 14: 49,289,821 (GRCm39) E19A probably damaging Het
Fam120b T C 17: 15,623,294 (GRCm39) L424P probably benign Het
Fam89a G A 8: 125,467,823 (GRCm39) T163I possibly damaging Het
Fcrl2 G A 3: 87,166,922 (GRCm39) L24F possibly damaging Het
Fgd6 G T 10: 93,975,715 (GRCm39) V1377L probably benign Het
Glud1 T A 14: 34,057,347 (GRCm39) I337K possibly damaging Het
Gm6370 T A 5: 146,430,736 (GRCm39) I303N probably benign Het
Gm7995 T C 14: 42,133,383 (GRCm39) Y88H probably damaging Het
Gsdma3 T C 11: 98,520,393 (GRCm39) probably null Het
Gsdmc2 T C 15: 63,707,614 (GRCm39) D60G probably damaging Het
Hcn1 T A 13: 118,039,431 (GRCm39) probably null Het
Hectd1 A T 12: 51,831,030 (GRCm39) C936* probably null Het
Herc4 T A 10: 63,121,433 (GRCm39) S358T probably benign Het
Hk3 A G 13: 55,158,735 (GRCm39) C515R probably benign Het
Ighg1 A G 12: 113,291,138 (GRCm39) probably benign Het
Iqgap3 T A 3: 88,014,842 (GRCm39) C853S probably benign Het
Irx4 G A 13: 73,415,750 (GRCm39) A180T probably damaging Het
Kif20b A G 19: 34,943,522 (GRCm39) T1441A probably benign Het
Lifr A G 15: 7,215,106 (GRCm39) K738E possibly damaging Het
Lmntd2 A T 7: 140,792,531 (GRCm39) S218T probably damaging Het
Lnx1 A T 5: 74,768,530 (GRCm39) W353R probably benign Het
Lrfn3 G T 7: 30,055,238 (GRCm39) P569Q possibly damaging Het
Mamstr A G 7: 45,293,838 (GRCm39) I11V probably benign Het
Med31 T C 11: 72,104,975 (GRCm39) N32S possibly damaging Het
Mob3c A T 4: 115,690,928 (GRCm39) I173F probably benign Het
Morc3 A G 16: 93,667,250 (GRCm39) probably null Het
Mphosph9 T C 5: 124,437,108 (GRCm39) K412R probably damaging Het
Mtcl3 A T 10: 29,072,537 (GRCm39) N610Y probably damaging Het
Mthfd1l C T 10: 3,957,775 (GRCm39) P271S probably benign Het
Ncam1 C T 9: 49,453,183 (GRCm39) probably null Het
Ncbp3 T A 11: 72,960,578 (GRCm39) Y279N probably damaging Het
Ncoa6 G A 2: 155,248,687 (GRCm39) T1539I probably benign Het
Nedd4 G A 9: 72,647,515 (GRCm39) probably null Het
Neil1 A G 9: 57,054,206 (GRCm39) V38A probably damaging Het
Ngf T A 3: 102,427,961 (GRCm39) F237I probably damaging Het
Nol3 A G 8: 106,005,888 (GRCm39) Q94R possibly damaging Het
Obox1 A G 7: 15,290,263 (GRCm39) N202S probably damaging Het
Odc1 T A 12: 17,597,386 (GRCm39) N29K possibly damaging Het
Or2b7 C T 13: 21,739,658 (GRCm39) R178H probably benign Het
Or2h15 T C 17: 38,441,508 (GRCm39) T192A probably damaging Het
Or4a69 C T 2: 89,312,652 (GRCm39) V276I probably benign Het
Or52a20 A C 7: 103,365,914 (GRCm39) I38L probably benign Het
P2rx7 T A 5: 122,819,129 (GRCm39) V517E probably damaging Het
Parm1 A G 5: 91,741,775 (GRCm39) T48A possibly damaging Het
Pcdh9 T A 14: 94,126,164 (GRCm39) D2V possibly damaging Het
Pgm3 G T 9: 86,451,378 (GRCm39) T92N probably damaging Het
Plcg2 G T 8: 118,333,872 (GRCm39) G882* probably null Het
Ptpn14 C T 1: 189,582,997 (GRCm39) P615S probably damaging Het
Ptprk A T 10: 28,464,928 (GRCm39) Y1244F probably damaging Het
Rere G A 4: 150,700,510 (GRCm39) A1162T probably damaging Het
Rfx2 T C 17: 57,090,747 (GRCm39) E391G probably damaging Het
Sema4c A G 1: 36,591,097 (GRCm39) V414A probably damaging Het
Serpinb10 A T 1: 107,468,681 (GRCm39) N185I probably damaging Het
Shroom3 T G 5: 93,098,993 (GRCm39) M1410R probably benign Het
Slc13a1 A T 6: 24,134,356 (GRCm39) S176T probably benign Het
Sntb1 A T 15: 55,506,198 (GRCm39) Y458* probably null Het
Sorcs1 C T 19: 50,220,741 (GRCm39) V570I probably benign Het
Sp8 T A 12: 118,812,805 (GRCm39) V220E probably damaging Het
Spry1 C T 3: 37,696,868 (GRCm39) T37M possibly damaging Het
Sspo A T 6: 48,437,756 (GRCm39) H1305L probably benign Het
Tmem108 A T 9: 103,376,276 (GRCm39) V391D possibly damaging Het
Tmem132d T A 5: 128,346,366 (GRCm39) H52L possibly damaging Het
Tmem132d T A 5: 128,346,364 (GRCm39) I53F probably damaging Het
Tnnt2 A T 1: 135,775,496 (GRCm39) R87* probably null Het
Ube3a A T 7: 58,893,198 (GRCm39) M1L probably benign Het
Unc79 A G 12: 103,060,592 (GRCm39) T1119A probably damaging Het
Usf3 A T 16: 44,039,942 (GRCm39) H1474L probably damaging Het
Vcpip1 G A 1: 9,817,423 (GRCm39) T320I probably damaging Het
Vmn1r56 A G 7: 5,199,443 (GRCm39) L58P probably damaging Het
Wdr53 A T 16: 32,075,796 (GRCm39) K334* probably null Het
Zbtb40 T A 4: 136,728,241 (GRCm39) R459W probably benign Het
Zfc3h1 T A 10: 115,246,547 (GRCm39) L878Q probably damaging Het
Zfp286 T C 11: 62,671,455 (GRCm39) D206G probably benign Het
Zfp46 T A 4: 136,017,792 (GRCm39) C209S probably damaging Het
Zup1 G T 10: 33,825,038 (GRCm39) T148K probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86,185,756 (GRCm39) missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86,275,404 (GRCm39) missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86,183,870 (GRCm39) missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86,123,372 (GRCm39) missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86,176,335 (GRCm39) missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86,381,027 (GRCm39) missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86,235,852 (GRCm39) splice site probably null
R1703:Tbc1d22a UTSW 15 86,123,416 (GRCm39) missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86,123,350 (GRCm39) missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86,275,266 (GRCm39) splice site probably null
R4380:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86,119,886 (GRCm39) missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86,196,037 (GRCm39) missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4920:Tbc1d22a UTSW 15 86,195,949 (GRCm39) missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86,275,287 (GRCm39) missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86,235,929 (GRCm39) missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86,098,809 (GRCm39) missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86,098,830 (GRCm39) missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86,185,768 (GRCm39) missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86,123,356 (GRCm39) missense probably benign 0.07
R7294:Tbc1d22a UTSW 15 86,196,036 (GRCm39) missense possibly damaging 0.90
R7645:Tbc1d22a UTSW 15 86,119,742 (GRCm39) missense probably benign 0.01
R7704:Tbc1d22a UTSW 15 86,250,876 (GRCm39) missense probably damaging 1.00
R9204:Tbc1d22a UTSW 15 86,098,803 (GRCm39) missense probably benign 0.15
R9370:Tbc1d22a UTSW 15 86,123,441 (GRCm39) missense probably benign 0.00
R9459:Tbc1d22a UTSW 15 86,120,021 (GRCm39) missense possibly damaging 0.57
R9792:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
R9793:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
RF013:Tbc1d22a UTSW 15 86,183,975 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGTAGGTCTCCCAGGTGTG -3'
(R):5'- CTTCTGAAGCTAGGAGTCTCTC -3'

Sequencing Primer
(F):5'- GTGCATTTGGGACCTGGCC -3'
(R):5'- GGTATCTCATCAAACTAGGCTGC -3'
Posted On 2016-03-17