Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Itk'

37547

Institutional Source

Beutler Lab

Gene Symbol

Itk

Ensembl Gene

ENSMUSG00000020395

Gene Name

IL2 inducible T cell kinase

Synonyms

Emt, Tsk, Tcsk

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R0281 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46325150-46389515 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46353916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 225 (Y225C)

Ref Sequence

ENSEMBL: ENSMUSP00000098864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000101306] [ENSMUST00000109237]

AlphaFold

Q03526

Predicted Effect

probably damaging
Transcript: ENSMUST00000020664
AA Change: Y225C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: Y225C

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART
SH2	237	328	9.44e-29	SMART
TyrKc	362	611	3.28e-133	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101306
AA Change: Y225C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098864
Gene: ENSMUSG00000020395
AA Change: Y225C

Domain	Start	End	E-Value	Type
PH	5	113	2.3e-13	SMART
BTK	113	149	1.1e-21	SMART
SH3	174	230	5.87e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109237
AA Change: Y231C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: Y231C

Domain	Start	End	E-Value	Type
PH	5	119	3.94e-12	SMART
BTK	119	155	1.1e-21	SMART
SH3	180	236	5.87e-14	SMART
SH2	243	334	9.44e-29	SMART
TyrKc	368	617	3.28e-133	SMART

Meta Mutation Damage Score

0.8248

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Itk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Itk	APN	11	46367896	missense	probably damaging	1.00
IGL01349:Itk	APN	11	46341200	missense	possibly damaging	0.84
IGL03290:Itk	APN	11	46334937	missense	probably damaging	1.00
IGL03385:Itk	APN	11	46331861	nonsense	probably null
Calame	UTSW	11	46342395	splice site	probably null
carbone	UTSW	11	46331949	nonsense	probably null
demon	UTSW	11	46340712	missense	probably damaging	1.00
goodnow	UTSW	11	46338099	splice site	probably null
itxaro	UTSW	11	46338217	missense	probably damaging	1.00
Segun	UTSW	11	46344883	intron	probably benign
BB009:Itk	UTSW	11	46340692	missense	probably benign
BB019:Itk	UTSW	11	46340692	missense	probably benign
R0095:Itk	UTSW	11	46342452	missense	probably damaging	0.99
R0265:Itk	UTSW	11	46389458	start gained	probably benign
R0463:Itk	UTSW	11	46331989	missense	probably damaging	1.00
R0518:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R0521:Itk	UTSW	11	46360288	missense	probably damaging	0.98
R1121:Itk	UTSW	11	46331894	missense	possibly damaging	0.93
R1550:Itk	UTSW	11	46389326	missense	probably damaging	1.00
R1762:Itk	UTSW	11	46336482	missense	probably damaging	0.98
R2418:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2419:Itk	UTSW	11	46338217	missense	probably damaging	1.00
R2859:Itk	UTSW	11	46344835	intron	probably benign
R3107:Itk	UTSW	11	46327464	missense	probably benign	0.15
R3546:Itk	UTSW	11	46355848	missense	probably benign	0.00
R4601:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4610:Itk	UTSW	11	46336515	missense	probably benign	0.17
R4792:Itk	UTSW	11	46344831	intron	probably benign
R4885:Itk	UTSW	11	46336344	splice site	probably null
R4934:Itk	UTSW	11	46389325	missense	probably damaging	1.00
R5286:Itk	UTSW	11	46338099	splice site	probably null
R5328:Itk	UTSW	11	46331876	missense	probably benign	0.04
R5399:Itk	UTSW	11	46338111	missense	probably benign	0.44
R5958:Itk	UTSW	11	46344855	intron	probably benign
R6235:Itk	UTSW	11	46336428	missense	probably benign	0.16
R6828:Itk	UTSW	11	46341218	missense	probably damaging	1.00
R6849:Itk	UTSW	11	46331935	missense	probably damaging	1.00
R7356:Itk	UTSW	11	46367832	missense	possibly damaging	0.72
R7753:Itk	UTSW	11	46331895	missense	probably damaging	1.00
R7932:Itk	UTSW	11	46340692	missense	probably benign
R7988:Itk	UTSW	11	46355834	missense	probably damaging	0.99
R8188:Itk	UTSW	11	46331949	nonsense	probably null
R8337:Itk	UTSW	11	46342395	splice site	probably null
R8738:Itk	UTSW	11	46340712	missense	probably damaging	1.00
R8993:Itk	UTSW	11	46334908	missense	probably damaging	1.00
R9028:Itk	UTSW	11	46344883	intron	probably benign
R9650:Itk	UTSW	11	46331951	missense	probably damaging	1.00
U24488:Itk	UTSW	11	46338144	missense	probably damaging	1.00
X0062:Itk	UTSW	11	46366044	missense	probably benign	0.15
Z1088:Itk	UTSW	11	46353862	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCCCCAAAGGACCATTCCATT -3'
(R):5'- AGGCAGCAAGCAGAGCCTTGTA -3'

Sequencing Primer
(F):5'- gcagacttaggaggcagagac -3'
(R):5'- GTTGCTTTCAACCACAAATATAGC -3'

Posted On

2013-05-23