Mutagenetix > Incidental Mutation

Incidental Mutation 'R4884:Hecw2'

375482

Institutional Source

Beutler Lab

Gene Symbol

Hecw2

Ensembl Gene

ENSMUSG00000042807

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2

Synonyms

A730039N16Rik, Nedl2, D030049F17Rik

MMRRC Submission

041978-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R4884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53806876-54195168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53950841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 125 (I125F)

Ref Sequence

ENSEMBL: ENSMUSP00000113283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087659] [ENSMUST00000097741] [ENSMUST00000120904]

AlphaFold

Q6I6G8

Predicted Effect

probably benign
Transcript: ENSMUST00000087659
AA Change: I125F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000084942
Gene: ENSMUSG00000042807
AA Change: I125F

Domain	Start	End	E-Value	Type
Pfam:HECW_N	45	164	4.6e-62	PFAM
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097741
AA Change: I125F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000095348
Gene: ENSMUSG00000042807
AA Change: I125F

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	1e-87	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	292	5.92e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120904
AA Change: I125F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113283
Gene: ENSMUSG00000042807
AA Change: I125F

Domain	Start	End	E-Value	Type
PDB:2LFE\|A	42	162	6e-80	PDB
low complexity region	165	178	N/A	INTRINSIC
C2	186	297	2.19e-12	SMART
low complexity region	577	596	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	746	755	N/A	INTRINSIC
low complexity region	769	786	N/A	INTRINSIC
WW	814	846	1.21e-11	SMART
coiled coil region	853	880	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
WW	992	1024	2.12e-7	SMART
Blast:HECTc	1111	1183	2e-23	BLAST
HECTc	1241	1578	8.02e-183	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146850

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of E3 ubiquitin ligases which plays an important role in the proliferation, migration and differentiation of neural crest cells as a regulator of glial cell line-derived neurotrophic factor (GDNF)/Ret signaling. This gene also plays an important role in angiogenesis through stabilization of endothelial cell-to-cell junctions as a regulator of angiomotin-like 1 stability. The encoded protein contains an N-terminal calcium/lipid-binding (C2) domain involved in membrane targeting, two-four WW domains responsible for cellular localization and substrate recognition, and a C-terminal homologous with E6-associated protein C-terminus (HECT) catalytic domain. Naturally occurring mutations in this gene are associated with neurodevelopmental delay, hypotonia, and epilepsy. The decreased expression of this gene in the aganglionic colon is associated with Hirschsprung's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,812	M417K	probably damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930452B06Rik	G	A	14: 8,578,394	T116I	probably damaging	Het
Aadat	C	T	8: 60,526,629	P175L	probably damaging	Het
Acot7	G	T	4: 152,186,207		probably benign	Het
Adad1	T	G	3: 37,076,664	F259V	possibly damaging	Het
Adora2a	A	G	10: 75,326,045	Y6C	probably null	Het
Ahnak	A	G	19: 9,012,754		probably benign	Het
Ankar	A	T	1: 72,698,807	M72K	probably damaging	Het
Ankrd45	A	G	1: 161,160,700	K176R	possibly damaging	Het
Ap3m2	T	C	8: 22,803,981	K18E	probably damaging	Het
Apol10b	C	T	15: 77,588,806	R16Q	possibly damaging	Het
Atp2b2	T	A	6: 113,842,186	T49S	possibly damaging	Het
B3gntl1	T	G	11: 121,629,969	Y206S	possibly damaging	Het
BC061237	G	A	14: 44,501,209	E22K	possibly damaging	Het
Bmp1	A	G	14: 70,475,215	V959A	probably benign	Het
C530008M17Rik	A	T	5: 76,848,835	I47F	probably damaging	Het
Cep295	T	C	9: 15,351,760	E169G	probably damaging	Het
Cfap65	T	G	1: 74,903,124	E1757A	possibly damaging	Het
Cgrrf1	T	A	14: 46,853,455	I216N	possibly damaging	Het
Clstn2	T	A	9: 97,799,395	D64V	probably damaging	Het
Col27a1	T	A	4: 63,275,960	D851E	possibly damaging	Het
Coq9	C	T	8: 94,853,194	P259L	probably benign	Het
Cps1	A	G	1: 67,177,024	N836S	probably benign	Het
Crebbp	T	C	16: 4,088,375	K1588E	probably damaging	Het
Cspg4	T	C	9: 56,898,069	W2055R	probably benign	Het
Cyp3a44	A	T	5: 145,777,982	M453K	probably damaging	Het
Dhx36	T	G	3: 62,484,260	D555A	probably damaging	Het
Dock2	A	T	11: 34,266,248	Y1219N	probably damaging	Het
Dpy19l2	A	T	9: 24,628,180	C492*	probably null	Het
Dusp22	A	G	13: 30,668,830	N16S	probably benign	Het
Epha1	A	G	6: 42,360,734	M805T	probably damaging	Het
Espl1	C	T	15: 102,324,070	A2071V	possibly damaging	Het
Fam160a1	A	C	3: 85,683,611	C178G	probably damaging	Het
Fbxo11	T	A	17: 87,992,333	D863V	probably damaging	Het
Fbxo7	T	A	10: 86,029,150	Y106N	probably damaging	Het
Fst	A	G	13: 114,454,384	V282A	probably damaging	Het
Gfra3	T	A	18: 34,711,251	M79L	probably benign	Het
Glp1r	T	C	17: 30,936,266	V409A	probably damaging	Het
Gm10799	T	A	2: 104,068,207	D51V	probably damaging	Het
Gm572	C	A	4: 148,667,362	T228N	possibly damaging	Het
Grip1	C	T	10: 120,075,306	T643M	probably damaging	Het
Hdgfl2	C	T	17: 56,096,265	R222C	possibly damaging	Het
Hipk1	A	G	3: 103,744,022	S1153P	possibly damaging	Het
Insm2	T	C	12: 55,599,761	S97P	probably damaging	Het
Iqca	A	G	1: 90,140,037	V164A	probably benign	Het
Kcna6	T	C	6: 126,738,726	D400G	probably benign	Het
Kctd1	T	C	18: 14,974,254	Y122C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra2	T	C	6: 131,230,202	Y148C	probably damaging	Het
Krtap31-1	G	A	11: 99,908,484	C171Y	unknown	Het
Ldlrap1	C	T	4: 134,758,971	R59Q	probably benign	Het
Ltb	T	C	17: 35,195,258	I3T	probably benign	Het
Macf1	T	C	4: 123,455,009	I2477V	probably benign	Het
Mpdz	A	T	4: 81,361,476	I39N	probably damaging	Het
Mycbp2	A	G	14: 103,211,295	I1776T	probably damaging	Het
Myof	T	A	19: 37,942,357	E994V	probably damaging	Het
Myom3	A	G	4: 135,783,055	E553G	possibly damaging	Het
Mysm1	A	T	4: 94,958,948	C504S	probably damaging	Het
Nectin3	A	T	16: 46,448,886	H384Q	probably benign	Het
Net1	G	A	13: 3,884,252	R482*	probably null	Het
Nit1	T	C	1: 171,343,695	K193R	probably null	Het
Nlgn1	A	G	3: 25,912,674	V205A	probably damaging	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nup62	T	A	7: 44,828,865	S101R	probably damaging	Het
Olfr1264	A	G	2: 90,021,643	V141A	probably benign	Het
Olfr1465	A	T	19: 13,313,670	I205N	probably benign	Het
Olfr1489	A	T	19: 13,634,027	K305N	probably benign	Het
Olfr155	T	C	4: 43,854,890	S194P	probably damaging	Het
Olfr355	G	T	2: 36,928,012	T34K	possibly damaging	Het
Olfr508	A	T	7: 108,630,612	I207F	probably damaging	Het
Olfr64	T	A	7: 103,893,655	I27F	probably benign	Het
Olfr663	T	A	7: 104,703,861	I98N	probably damaging	Het
Osbpl6	A	T	2: 76,549,539	I158F	probably damaging	Het
Pcbp4	A	G	9: 106,462,102	T103A	probably benign	Het
Pcdha2	T	A	18: 36,940,900	L528Q	probably damaging	Het
Pcdhga5	T	C	18: 37,694,627	S43P	probably damaging	Het
Pdgfra	C	A	5: 75,189,312	N952K	probably benign	Het
Pla2r1	A	G	2: 60,534,984	S81P	probably damaging	Het
Ppp1r32	A	T	19: 10,474,501	*428R	probably null	Het
Rabggtb	A	T	3: 153,911,931	D43E	possibly damaging	Het
Rexo5	T	A	7: 119,825,551	C43*	probably null	Het
Robo1	T	A	16: 72,904,751	D168E	probably damaging	Het
Scimp	A	G	11: 70,798,039	M49T	unknown	Het
Sema3e	T	A	5: 14,225,565	V228E	probably damaging	Het
Sema6d	A	G	2: 124,656,818		probably null	Het
Serpinb6d	A	T	13: 33,666,445	D85V	possibly damaging	Het
Slc24a2	C	T	4: 86,991,508	V658I	probably damaging	Het
Snd1	T	C	6: 28,526,912	I198T	possibly damaging	Het
Snx33	C	T	9: 56,926,180	V202M	probably damaging	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Srcap	A	G	7: 127,522,017	E174G	probably damaging	Het
Srgap2	C	A	1: 131,292,576		probably null	Het
Stxbp5	A	T	10: 9,812,341	Y405*	probably null	Het
Thsd4	C	T	9: 59,988,037	R710H	probably benign	Het
Trp53inp1	T	A	4: 11,165,130	D51E	probably benign	Het
Ttc41	A	G	10: 86,731,018	D516G	probably benign	Het
Uap1l1	A	G	2: 25,362,828	V400A	probably damaging	Het
Vit	T	C	17: 78,624,753	S430P	probably damaging	Het
Vmn1r9	T	A	6: 57,071,309	M123K	possibly damaging	Het
Vmn2r14	A	T	5: 109,221,518		probably null	Het
Vwa3a	A	G	7: 120,791,701	T746A	probably benign	Het
Wdfy4	G	T	14: 32,988,895	Y2578*	probably null	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Xpot	G	T	10: 121,606,808	H495Q	probably damaging	Het
Zcchc6	A	T	13: 59,789,452	L775H	probably damaging	Het
Zfp109	T	C	7: 24,229,145	T288A	probably benign	Het
Zfp277	T	A	12: 40,363,153	E276V	probably damaging	Het
Zfp703	A	G	8: 26,978,701	D131G	probably benign	Het
Zfp985	T	A	4: 147,583,344	I223N	probably benign	Het
Zrsr1	T	C	11: 22,973,805	V193A	possibly damaging	Het
Zscan20	A	G	4: 128,588,165	I568T	possibly damaging	Het

Other mutations in Hecw2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Hecw2	APN	1	53830737	missense	probably damaging	1.00
IGL00338:Hecw2	APN	1	53827881	splice site	probably benign
IGL00530:Hecw2	APN	1	53853280	missense	probably damaging	1.00
IGL01343:Hecw2	APN	1	53826976	missense	probably damaging	0.96
IGL01503:Hecw2	APN	1	53826961	missense	probably damaging	1.00
IGL01989:Hecw2	APN	1	53840792	missense	probably damaging	1.00
IGL02016:Hecw2	APN	1	53831543	missense	possibly damaging	0.73
IGL02052:Hecw2	APN	1	53926511	missense	probably benign
IGL02085:Hecw2	APN	1	53942802	critical splice acceptor site	probably null
IGL02302:Hecw2	APN	1	53933248	missense	probably damaging	1.00
IGL02310:Hecw2	APN	1	53923916	missense	probably null	0.38
IGL02388:Hecw2	APN	1	53925699	missense	probably benign	0.17
IGL02499:Hecw2	APN	1	53926488	missense	probably benign
IGL02695:Hecw2	APN	1	53926209	missense	possibly damaging	0.94
IGL02732:Hecw2	APN	1	53926688	splice site	probably benign
IGL03100:Hecw2	APN	1	53831656	missense	probably damaging	1.00
IGL03175:Hecw2	APN	1	53926257	missense	possibly damaging	0.51
IGL03253:Hecw2	APN	1	53832716	missense	possibly damaging	0.85
IGL03356:Hecw2	APN	1	53927058	splice site	probably benign
Memoriam	UTSW	1	53926056	missense	probably benign
recollect	UTSW	1	53904422	missense	possibly damaging	0.88
ANU74:Hecw2	UTSW	1	53925694	missense	probably benign	0.01
R0077:Hecw2	UTSW	1	53868831	splice site	probably benign
R0133:Hecw2	UTSW	1	53830740	missense	probably damaging	1.00
R0268:Hecw2	UTSW	1	53926698	splice site	probably benign
R1303:Hecw2	UTSW	1	54040393	missense	probably benign	0.00
R1460:Hecw2	UTSW	1	53813245	missense	probably damaging	0.96
R1524:Hecw2	UTSW	1	53851618	missense	probably damaging	1.00
R1533:Hecw2	UTSW	1	53926545	splice site	probably null
R1828:Hecw2	UTSW	1	53926023	missense	probably benign
R2170:Hecw2	UTSW	1	53942797	missense	probably damaging	0.99
R2338:Hecw2	UTSW	1	53904422	missense	possibly damaging	0.88
R3016:Hecw2	UTSW	1	53830680	missense	probably damaging	1.00
R3872:Hecw2	UTSW	1	53832757	splice site	probably benign
R3892:Hecw2	UTSW	1	53926121	missense	probably benign	0.01
R4086:Hecw2	UTSW	1	53831656	missense	probably damaging	1.00
R4247:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4248:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4249:Hecw2	UTSW	1	53832645	missense	probably damaging	1.00
R4545:Hecw2	UTSW	1	53813222	makesense	probably null
R4805:Hecw2	UTSW	1	53840859	missense	probably damaging	1.00
R4834:Hecw2	UTSW	1	53830752	missense	probably damaging	1.00
R4983:Hecw2	UTSW	1	53832671	missense	probably benign	0.42
R5168:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R5482:Hecw2	UTSW	1	53926201	missense	probably benign	0.09
R5549:Hecw2	UTSW	1	53925691	missense	possibly damaging	0.91
R5623:Hecw2	UTSW	1	53832623	missense	probably null	1.00
R5740:Hecw2	UTSW	1	53887603	missense	probably benign	0.12
R5919:Hecw2	UTSW	1	53937090	missense	probably damaging	0.99
R6058:Hecw2	UTSW	1	53923976	missense	possibly damaging	0.67
R6460:Hecw2	UTSW	1	53868833	splice site	probably null
R6875:Hecw2	UTSW	1	53937132	missense	probably benign	0.01
R7097:Hecw2	UTSW	1	53865124	missense	possibly damaging	0.88
R7131:Hecw2	UTSW	1	53865121	missense	probably damaging	1.00
R7291:Hecw2	UTSW	1	53914594	missense	probably damaging	1.00
R7401:Hecw2	UTSW	1	53904343	missense	probably damaging	1.00
R7482:Hecw2	UTSW	1	54040470	missense	probably damaging	0.99
R7501:Hecw2	UTSW	1	53913872	critical splice acceptor site	probably null
R7520:Hecw2	UTSW	1	53926056	missense	probably benign
R7611:Hecw2	UTSW	1	53913300	missense	probably damaging	1.00
R8184:Hecw2	UTSW	1	54040387	missense	probably benign	0.37
R8286:Hecw2	UTSW	1	53840769	missense	probably damaging	1.00
R8300:Hecw2	UTSW	1	53887616	missense	probably null	0.07
R8354:Hecw2	UTSW	1	53925308	critical splice donor site	probably null
R8362:Hecw2	UTSW	1	54040491	start codon destroyed	probably null	0.51
R8691:Hecw2	UTSW	1	53865064	missense	probably benign	0.26
R8745:Hecw2	UTSW	1	53933171	missense	probably damaging	1.00
R8769:Hecw2	UTSW	1	53913348	missense	probably benign	0.00
R8830:Hecw2	UTSW	1	53891146	missense	probably damaging	1.00
R8842:Hecw2	UTSW	1	53950874	missense
R8874:Hecw2	UTSW	1	53904449	splice site	probably benign
R9064:Hecw2	UTSW	1	53826886	missense	probably benign	0.08
R9326:Hecw2	UTSW	1	54040210	missense	probably damaging	1.00
R9450:Hecw2	UTSW	1	53839029	nonsense	probably null
R9486:Hecw2	UTSW	1	53813307	missense	probably damaging	1.00
R9763:Hecw2	UTSW	1	53923915	missense	probably damaging	1.00
R9766:Hecw2	UTSW	1	53865128	missense	probably damaging	1.00
Z1177:Hecw2	UTSW	1	53923943	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCACAACATTGAACTCTCTGATTCC -3'
(R):5'- AGTGTTCACTGATGGTCTGCC -3'

Sequencing Primer
(F):5'- CTCCAGTGAACATTTTCTAAACAAC -3'
(R):5'- ACTGATGGTCTGCCTTCTTTATC -3'

Posted On

2016-03-17