Incidental Mutation 'R4884:Cfap65'
ID 375485
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 041978-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R4884 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 74942283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1757 (E1757A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083682
Predicted Effect possibly damaging
Transcript: ENSMUST00000094844
AA Change: E1757A

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: E1757A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Aadat C T 8: 60,979,663 (GRCm39) P175L probably damaging Het
Acot7 G T 4: 152,270,664 (GRCm39) probably benign Het
Adad1 T G 3: 37,130,813 (GRCm39) F259V possibly damaging Het
Adora2a A G 10: 75,161,879 (GRCm39) Y6C probably null Het
Ahnak A G 19: 8,990,118 (GRCm39) probably benign Het
Ankar A T 1: 72,737,966 (GRCm39) M72K probably damaging Het
Ankrd45 A G 1: 160,988,270 (GRCm39) K176R possibly damaging Het
Ap3m2 T C 8: 23,293,997 (GRCm39) K18E probably damaging Het
Apol10b C T 15: 77,473,006 (GRCm39) R16Q possibly damaging Het
Atp2b2 T A 6: 113,819,147 (GRCm39) T49S possibly damaging Het
B3gntl1 T G 11: 121,520,795 (GRCm39) Y206S possibly damaging Het
BC061237 G A 14: 44,738,666 (GRCm39) E22K possibly damaging Het
Bmp1 A G 14: 70,712,655 (GRCm39) V959A probably benign Het
Cep295 T C 9: 15,263,056 (GRCm39) E169G probably damaging Het
Cfap20dc G A 14: 8,578,394 (GRCm38) T116I probably damaging Het
Cgrrf1 T A 14: 47,090,912 (GRCm39) I216N possibly damaging Het
Clstn2 T A 9: 97,681,448 (GRCm39) D64V probably damaging Het
Col27a1 T A 4: 63,194,197 (GRCm39) D851E possibly damaging Het
Coq9 C T 8: 95,579,822 (GRCm39) P259L probably benign Het
Cps1 A G 1: 67,216,183 (GRCm39) N836S probably benign Het
Cracd A T 5: 76,996,682 (GRCm39) I47F probably damaging Het
Crebbp T C 16: 3,906,239 (GRCm39) K1588E probably damaging Het
Cspg4 T C 9: 56,805,353 (GRCm39) W2055R probably benign Het
Cyp3a44 A T 5: 145,714,792 (GRCm39) M453K probably damaging Het
Dhx36 T G 3: 62,391,681 (GRCm39) D555A probably damaging Het
Dock2 A T 11: 34,216,248 (GRCm39) Y1219N probably damaging Het
Dpy19l2 A T 9: 24,539,476 (GRCm39) C492* probably null Het
Dusp22 A G 13: 30,852,813 (GRCm39) N16S probably benign Het
Epha1 A G 6: 42,337,668 (GRCm39) M805T probably damaging Het
Espl1 C T 15: 102,232,505 (GRCm39) A2071V possibly damaging Het
Fbxo11 T A 17: 88,299,761 (GRCm39) D863V probably damaging Het
Fbxo7 T A 10: 85,865,014 (GRCm39) Y106N probably damaging Het
Fhip1a A C 3: 85,590,918 (GRCm39) C178G probably damaging Het
Fst A G 13: 114,590,920 (GRCm39) V282A probably damaging Het
Gfra3 T A 18: 34,844,304 (GRCm39) M79L probably benign Het
Glp1r T C 17: 31,155,240 (GRCm39) V409A probably damaging Het
Gm10799 T A 2: 103,898,552 (GRCm39) D51V probably damaging Het
Gm572 C A 4: 148,751,819 (GRCm39) T228N possibly damaging Het
Grip1 C T 10: 119,911,211 (GRCm39) T643M probably damaging Het
Hdgfl2 C T 17: 56,403,265 (GRCm39) R222C possibly damaging Het
Hecw2 T A 1: 53,990,000 (GRCm39) I125F probably benign Het
Hipk1 A G 3: 103,651,338 (GRCm39) S1153P possibly damaging Het
Insm2 T C 12: 55,646,546 (GRCm39) S97P probably damaging Het
Iqca1 A G 1: 90,067,759 (GRCm39) V164A probably benign Het
Kcna6 T C 6: 126,715,689 (GRCm39) D400G probably benign Het
Kctd1 T C 18: 15,107,311 (GRCm39) Y122C probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Klra2 T C 6: 131,207,165 (GRCm39) Y148C probably damaging Het
Krtap31-1 G A 11: 99,799,310 (GRCm39) C171Y unknown Het
Ldlrap1 C T 4: 134,486,282 (GRCm39) R59Q probably benign Het
Ltb T C 17: 35,414,234 (GRCm39) I3T probably benign Het
Macf1 T C 4: 123,348,802 (GRCm39) I2477V probably benign Het
Mpdz A T 4: 81,279,713 (GRCm39) I39N probably damaging Het
Mtcl3 A T 10: 29,072,537 (GRCm39) N610Y probably damaging Het
Mycbp2 A G 14: 103,448,731 (GRCm39) I1776T probably damaging Het
Myof T A 19: 37,930,805 (GRCm39) E994V probably damaging Het
Myom3 A G 4: 135,510,366 (GRCm39) E553G possibly damaging Het
Mysm1 A T 4: 94,847,185 (GRCm39) C504S probably damaging Het
Nectin3 A T 16: 46,269,249 (GRCm39) H384Q probably benign Het
Net1 G A 13: 3,934,252 (GRCm39) R482* probably null Het
Nit1 T C 1: 171,171,263 (GRCm39) K193R probably null Het
Nlgn1 A G 3: 25,966,838 (GRCm39) V205A probably damaging Het
Nr3c2 A T 8: 77,635,438 (GRCm39) I180F possibly damaging Het
Nup50l A T 6: 96,141,793 (GRCm39) M417K probably damaging Het
Nup62 T A 7: 44,478,289 (GRCm39) S101R probably damaging Het
Or13c7 T C 4: 43,854,890 (GRCm39) S194P probably damaging Het
Or1l8 G T 2: 36,818,024 (GRCm39) T34K possibly damaging Het
Or4c3 A G 2: 89,851,987 (GRCm39) V141A probably benign Het
Or51b17 T A 7: 103,542,862 (GRCm39) I27F probably benign Het
Or56b2j T A 7: 104,353,068 (GRCm39) I98N probably damaging Het
Or5b111 A T 19: 13,291,034 (GRCm39) I205N probably benign Het
Or5b124 A T 19: 13,611,391 (GRCm39) K305N probably benign Het
Or5p80 A T 7: 108,229,819 (GRCm39) I207F probably damaging Het
Osbpl6 A T 2: 76,379,883 (GRCm39) I158F probably damaging Het
Pcbp4 A G 9: 106,339,301 (GRCm39) T103A probably benign Het
Pcdha2 T A 18: 37,073,953 (GRCm39) L528Q probably damaging Het
Pcdhga5 T C 18: 37,827,680 (GRCm39) S43P probably damaging Het
Pdgfra C A 5: 75,349,973 (GRCm39) N952K probably benign Het
Pla2r1 A G 2: 60,365,328 (GRCm39) S81P probably damaging Het
Rabggtb A T 3: 153,617,568 (GRCm39) D43E possibly damaging Het
Rexo5 T A 7: 119,424,774 (GRCm39) C43* probably null Het
Robo1 T A 16: 72,701,639 (GRCm39) D168E probably damaging Het
Saxo4 A T 19: 10,451,865 (GRCm39) *428R probably null Het
Scimp A G 11: 70,688,865 (GRCm39) M49T unknown Het
Sema3e T A 5: 14,275,579 (GRCm39) V228E probably damaging Het
Sema6d A G 2: 124,498,738 (GRCm39) probably null Het
Serpinb6d A T 13: 33,850,428 (GRCm39) D85V possibly damaging Het
Slc24a2 C T 4: 86,909,745 (GRCm39) V658I probably damaging Het
Snd1 T C 6: 28,526,911 (GRCm39) I198T possibly damaging Het
Snx33 C T 9: 56,833,464 (GRCm39) V202M probably damaging Het
Srcap A G 7: 127,121,189 (GRCm39) E174G probably damaging Het
Srgap2 C A 1: 131,220,314 (GRCm39) probably null Het
Stxbp5 A T 10: 9,688,085 (GRCm39) Y405* probably null Het
Thsd4 C T 9: 59,895,320 (GRCm39) R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 (GRCm39) D51E probably benign Het
Ttc41 A G 10: 86,566,882 (GRCm39) D516G probably benign Het
Tut7 A T 13: 59,937,266 (GRCm39) L775H probably damaging Het
Uap1l1 A G 2: 25,252,840 (GRCm39) V400A probably damaging Het
Vit T C 17: 78,932,182 (GRCm39) S430P probably damaging Het
Vmn1r9 T A 6: 57,048,294 (GRCm39) M123K possibly damaging Het
Vmn2r14 A T 5: 109,369,384 (GRCm39) probably null Het
Vwa3a A G 7: 120,390,924 (GRCm39) T746A probably benign Het
Wdfy4 G T 14: 32,710,852 (GRCm39) Y2578* probably null Het
Wdr53 A T 16: 32,075,796 (GRCm39) K334* probably null Het
Xpot G T 10: 121,442,713 (GRCm39) H495Q probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zfp277 T A 12: 40,413,152 (GRCm39) E276V probably damaging Het
Zfp703 A G 8: 27,468,729 (GRCm39) D131G probably benign Het
Zfp985 T A 4: 147,667,801 (GRCm39) I223N probably benign Het
Zrsr2-ps1 T C 11: 22,923,805 (GRCm39) V193A possibly damaging Het
Zscan20 A G 4: 128,481,958 (GRCm39) I568T possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCAAACGCTATCAATCAG -3'
(R):5'- ACTTAGTGCCGATCCTGTCC -3'

Sequencing Primer
(F):5'- TGGCAAACGCTATCAATCAGGTATC -3'
(R):5'- ACCTTTTTGGGAAGATGCCAG -3'
Posted On 2016-03-17