Incidental Mutation 'R4884:Cfap65'
ID375485
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission 041978-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4884 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74903124 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1757 (E1757A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083682
Predicted Effect possibly damaging
Transcript: ENSMUST00000094844
AA Change: E1757A

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: E1757A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Aadat C T 8: 60,526,629 P175L probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cspg4 T C 9: 56,898,069 W2055R probably benign Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myof T A 19: 37,942,357 E994V probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCAAACGCTATCAATCAG -3'
(R):5'- ACTTAGTGCCGATCCTGTCC -3'

Sequencing Primer
(F):5'- TGGCAAACGCTATCAATCAGGTATC -3'
(R):5'- ACCTTTTTGGGAAGATGCCAG -3'
Posted On2016-03-17