Incidental Mutation 'R4884:Aadat'
ID375547
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Nameaminoadipate aminotransferase
SynonymsKATII, Kat2, mKat-2
MMRRC Submission 041978-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4884 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60505932-60545677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60526629 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 175 (P175L)
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
Predicted Effect probably damaging
Transcript: ENSMUST00000079472
AA Change: P168L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228
AA Change: P168L

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209338
AA Change: P175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cfap65 T G 1: 74,903,124 E1757A possibly damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cspg4 T C 9: 56,898,069 W2055R probably benign Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myof T A 19: 37,942,357 E994V probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R2362:Aadat UTSW 8 60532298 splice site probably benign
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4126:Aadat UTSW 8 60531669 missense probably benign 0.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R5367:Aadat UTSW 8 60526596 missense probably damaging 1.00
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
R7634:Aadat UTSW 8 60516068 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TATACAGCTCACTCTTCCAAAGTAC -3'
(R):5'- GAACACATTCTGGTCACCCTC -3'

Sequencing Primer
(F):5'- TTACATGTTTAAGGGCATGAGCAG -3'
(R):5'- GTCACCCTCTTGTAATTACCTCATAG -3'
Posted On2016-03-17