Incidental Mutation 'R4884:Nr3c2'
ID375548
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
MMRRC Submission 041978-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4884 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76908809 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 180 (I180F)
Ref Sequence ENSEMBL: ENSMUSP00000105537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]
Predicted Effect probably benign
Transcript: ENSMUST00000034031
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: I180F

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109911
AA Change: I180F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: I180F

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109912
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: I180F

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109913
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: I180F

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128862
Predicted Effect probably benign
Transcript: ENSMUST00000143284
Predicted Effect probably benign
Transcript: ENSMUST00000148106
AA Change: I180F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: I180F

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Aadat C T 8: 60,526,629 P175L probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cfap65 T G 1: 74,903,124 E1757A possibly damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cspg4 T C 9: 56,898,069 W2055R probably benign Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myof T A 19: 37,942,357 E994V probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTGTGAGAGATGCCGAGTAC -3'
(R):5'- AGCCTCTATTTTCAACACTGGG -3'

Sequencing Primer
(F):5'- GATGCCGAGTACACTTATGATCAGC -3'
(R):5'- CTCTATTTTCAACACTGGGGGAGC -3'
Posted On2016-03-17