Incidental Mutation 'R0281:Lasp1'
ID37556
Institutional Source Beutler Lab
Gene Symbol Lasp1
Ensembl Gene ENSMUSG00000038366
Gene NameLIM and SH3 protein 1
SynonymsTg(Col1a1-lacZ)1Ngma, Def-4, Tg(11Col1a1)NG, SH3P6
MMRRC Submission 038503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R0281 (G1)
Quality Score154
Status Validated
Chromosome11
Chromosomal Location97799000-97838764 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 97806851 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 32 (C32*)
Ref Sequence ENSEMBL: ENSMUSP00000042123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043843] [ENSMUST00000127033] [ENSMUST00000129558] [ENSMUST00000129828] [ENSMUST00000134428] [ENSMUST00000136723] [ENSMUST00000138919] [ENSMUST00000143571] [ENSMUST00000146572] [ENSMUST00000148280] [ENSMUST00000152962] [ENSMUST00000153520]
Predicted Effect probably null
Transcript: ENSMUST00000043843
AA Change: C32*
SMART Domains Protein: ENSMUSP00000042123
Gene: ENSMUSG00000038366
AA Change: C32*

DomainStartEndE-ValueType
LIM 4 56 4.34e-15 SMART
NEBU 62 92 1.1e-8 SMART
NEBU 98 128 1.05e-9 SMART
low complexity region 174 180 N/A INTRINSIC
SH3 207 263 8.11e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107569
Predicted Effect probably benign
Transcript: ENSMUST00000127033
SMART Domains Protein: ENSMUSP00000127792
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129558
SMART Domains Protein: ENSMUSP00000123165
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129828
SMART Domains Protein: ENSMUSP00000115308
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134428
Predicted Effect probably benign
Transcript: ENSMUST00000136723
SMART Domains Protein: ENSMUSP00000114306
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
Pfam:Nebulin 31 59 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138919
Predicted Effect probably benign
Transcript: ENSMUST00000143571
Predicted Effect probably benign
Transcript: ENSMUST00000146572
SMART Domains Protein: ENSMUSP00000121907
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
Pfam:Nebulin 31 59 2.1e-12 PFAM
Pfam:Nebulin 67 89 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148280
SMART Domains Protein: ENSMUSP00000123050
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
low complexity region 138 144 N/A INTRINSIC
SCOP:d1awj__ 155 186 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152962
SMART Domains Protein: ENSMUSP00000120645
Gene: ENSMUSG00000038366

DomainStartEndE-ValueType
Blast:LIM 1 20 4e-7 BLAST
NEBU 26 56 1.1e-8 SMART
NEBU 62 92 1.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153520
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced histamine-stimulated gastric acid secretion and enlarged heart and testes on a mixed background. Mice homozygous for a transgene insertion exhibit abnormal tail vertebrae with scoliosis, transient spina bifida occulta, and a bent tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcc5 T A 16: 20,422,400 I12F probably damaging Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cep192 A G 18: 67,828,482 probably benign Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Col6a6 T A 9: 105,784,116 M265L probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hectd4 G A 5: 121,254,251 D193N possibly damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Smarcc2 A G 10: 128,474,722 T407A probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Lasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Lasp1 APN 11 97836190 missense probably damaging 1.00
R2126:Lasp1 UTSW 11 97836134 missense probably benign 0.34
R3906:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3908:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R3909:Lasp1 UTSW 11 97799827 missense probably damaging 1.00
R4908:Lasp1 UTSW 11 97833704 critical splice donor site probably null
R5239:Lasp1 UTSW 11 97799860 missense probably damaging 1.00
R6519:Lasp1 UTSW 11 97815557 unclassified probably null
R6576:Lasp1 UTSW 11 97833576 missense probably damaging 1.00
R6629:Lasp1 UTSW 11 97806896 nonsense probably null
R7001:Lasp1 UTSW 11 97806833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCAGAGCTTGTGACCTGAAG -3'
(R):5'- TGTCCAGGAACCAGCCTCACATTG -3'

Sequencing Primer
(F):5'- TTGTGACCTGAAGTGGCCC -3'
(R):5'- ttaagaaagtcccctcctgtg -3'
Posted On2013-05-23