Incidental Mutation 'R4884:2700049A03Rik'
ID375573
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 041978-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4884 (G1)
Quality Score219
Status Not validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71164547 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 685 (E685V)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Aadat C T 8: 60,526,629 P175L probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cfap65 T G 1: 74,903,124 E1757A possibly damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cspg4 T C 9: 56,898,069 W2055R probably benign Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myof T A 19: 37,942,357 E994V probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- CTGTTCCCTGGCAGATAACG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'
Posted On2016-03-17