Mutagenetix > Incidental Mutation

Incidental Mutation 'R4884:Wdfy4'

375581

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

041978-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 32988895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2578 (Y2578*)

Ref Sequence

ENSEMBL: ENSMUSP00000117068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038956] [ENSMUST00000061753] [ENSMUST00000120588] [ENSMUST00000120866] [ENSMUST00000120951] [ENSMUST00000123822] [ENSMUST00000130509]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038956

SMART Domains

Protein: ENSMUSP00000041199
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	114	3.5e-2	PFAM
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000061753
AA Change: Y2419*

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: Y2419*

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120588

SMART Domains

Protein: ENSMUSP00000113825
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120866

SMART Domains

Protein: ENSMUSP00000113608
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	114	5.3e-2	PFAM
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120951

SMART Domains

Protein: ENSMUSP00000113965
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
LRR	120	142	1.26e2	SMART
LRR	143	166	1.49e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123822

SMART Domains

Protein: ENSMUSP00000123178
Gene: ENSMUSG00000041673

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
LRR	49	71	3.27e1	SMART
LRR	72	95	1.31e0	SMART
Pfam:LRR_7	96	110	4.6e-2	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130509
AA Change: Y2578*

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: Y2578*

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,812	M417K	probably damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930452B06Rik	G	A	14: 8,578,394	T116I	probably damaging	Het
Aadat	C	T	8: 60,526,629	P175L	probably damaging	Het
Acot7	G	T	4: 152,186,207		probably benign	Het
Adad1	T	G	3: 37,076,664	F259V	possibly damaging	Het
Adora2a	A	G	10: 75,326,045	Y6C	probably null	Het
Ahnak	A	G	19: 9,012,754		probably benign	Het
Ankar	A	T	1: 72,698,807	M72K	probably damaging	Het
Ankrd45	A	G	1: 161,160,700	K176R	possibly damaging	Het
Ap3m2	T	C	8: 22,803,981	K18E	probably damaging	Het
Apol10b	C	T	15: 77,588,806	R16Q	possibly damaging	Het
Atp2b2	T	A	6: 113,842,186	T49S	possibly damaging	Het
B3gntl1	T	G	11: 121,629,969	Y206S	possibly damaging	Het
BC061237	G	A	14: 44,501,209	E22K	possibly damaging	Het
Bmp1	A	G	14: 70,475,215	V959A	probably benign	Het
C530008M17Rik	A	T	5: 76,848,835	I47F	probably damaging	Het
Cep295	T	C	9: 15,351,760	E169G	probably damaging	Het
Cfap65	T	G	1: 74,903,124	E1757A	possibly damaging	Het
Cgrrf1	T	A	14: 46,853,455	I216N	possibly damaging	Het
Clstn2	T	A	9: 97,799,395	D64V	probably damaging	Het
Col27a1	T	A	4: 63,275,960	D851E	possibly damaging	Het
Coq9	C	T	8: 94,853,194	P259L	probably benign	Het
Cps1	A	G	1: 67,177,024	N836S	probably benign	Het
Crebbp	T	C	16: 4,088,375	K1588E	probably damaging	Het
Cspg4	T	C	9: 56,898,069	W2055R	probably benign	Het
Cyp3a44	A	T	5: 145,777,982	M453K	probably damaging	Het
Dhx36	T	G	3: 62,484,260	D555A	probably damaging	Het
Dock2	A	T	11: 34,266,248	Y1219N	probably damaging	Het
Dpy19l2	A	T	9: 24,628,180	C492*	probably null	Het
Dusp22	A	G	13: 30,668,830	N16S	probably benign	Het
Epha1	A	G	6: 42,360,734	M805T	probably damaging	Het
Espl1	C	T	15: 102,324,070	A2071V	possibly damaging	Het
Fam160a1	A	C	3: 85,683,611	C178G	probably damaging	Het
Fbxo11	T	A	17: 87,992,333	D863V	probably damaging	Het
Fbxo7	T	A	10: 86,029,150	Y106N	probably damaging	Het
Fst	A	G	13: 114,454,384	V282A	probably damaging	Het
Gfra3	T	A	18: 34,711,251	M79L	probably benign	Het
Glp1r	T	C	17: 30,936,266	V409A	probably damaging	Het
Gm10799	T	A	2: 104,068,207	D51V	probably damaging	Het
Gm572	C	A	4: 148,667,362	T228N	possibly damaging	Het
Grip1	C	T	10: 120,075,306	T643M	probably damaging	Het
Hdgfl2	C	T	17: 56,096,265	R222C	possibly damaging	Het
Hecw2	T	A	1: 53,950,841	I125F	probably benign	Het
Hipk1	A	G	3: 103,744,022	S1153P	possibly damaging	Het
Insm2	T	C	12: 55,599,761	S97P	probably damaging	Het
Iqca	A	G	1: 90,140,037	V164A	probably benign	Het
Kcna6	T	C	6: 126,738,726	D400G	probably benign	Het
Kctd1	T	C	18: 14,974,254	Y122C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra2	T	C	6: 131,230,202	Y148C	probably damaging	Het
Krtap31-1	G	A	11: 99,908,484	C171Y	unknown	Het
Ldlrap1	C	T	4: 134,758,971	R59Q	probably benign	Het
Ltb	T	C	17: 35,195,258	I3T	probably benign	Het
Macf1	T	C	4: 123,455,009	I2477V	probably benign	Het
Mpdz	A	T	4: 81,361,476	I39N	probably damaging	Het
Mycbp2	A	G	14: 103,211,295	I1776T	probably damaging	Het
Myof	T	A	19: 37,942,357	E994V	probably damaging	Het
Myom3	A	G	4: 135,783,055	E553G	possibly damaging	Het
Mysm1	A	T	4: 94,958,948	C504S	probably damaging	Het
Nectin3	A	T	16: 46,448,886	H384Q	probably benign	Het
Net1	G	A	13: 3,884,252	R482*	probably null	Het
Nit1	T	C	1: 171,343,695	K193R	probably null	Het
Nlgn1	A	G	3: 25,912,674	V205A	probably damaging	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nup62	T	A	7: 44,828,865	S101R	probably damaging	Het
Olfr1264	A	G	2: 90,021,643	V141A	probably benign	Het
Olfr1465	A	T	19: 13,313,670	I205N	probably benign	Het
Olfr1489	A	T	19: 13,634,027	K305N	probably benign	Het
Olfr155	T	C	4: 43,854,890	S194P	probably damaging	Het
Olfr355	G	T	2: 36,928,012	T34K	possibly damaging	Het
Olfr508	A	T	7: 108,630,612	I207F	probably damaging	Het
Olfr64	T	A	7: 103,893,655	I27F	probably benign	Het
Olfr663	T	A	7: 104,703,861	I98N	probably damaging	Het
Osbpl6	A	T	2: 76,549,539	I158F	probably damaging	Het
Pcbp4	A	G	9: 106,462,102	T103A	probably benign	Het
Pcdha2	T	A	18: 36,940,900	L528Q	probably damaging	Het
Pcdhga5	T	C	18: 37,694,627	S43P	probably damaging	Het
Pdgfra	C	A	5: 75,189,312	N952K	probably benign	Het
Pla2r1	A	G	2: 60,534,984	S81P	probably damaging	Het
Ppp1r32	A	T	19: 10,474,501	*428R	probably null	Het
Rabggtb	A	T	3: 153,911,931	D43E	possibly damaging	Het
Rexo5	T	A	7: 119,825,551	C43*	probably null	Het
Robo1	T	A	16: 72,904,751	D168E	probably damaging	Het
Scimp	A	G	11: 70,798,039	M49T	unknown	Het
Sema3e	T	A	5: 14,225,565	V228E	probably damaging	Het
Sema6d	A	G	2: 124,656,818		probably null	Het
Serpinb6d	A	T	13: 33,666,445	D85V	possibly damaging	Het
Slc24a2	C	T	4: 86,991,508	V658I	probably damaging	Het
Snd1	T	C	6: 28,526,912	I198T	possibly damaging	Het
Snx33	C	T	9: 56,926,180	V202M	probably damaging	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Srcap	A	G	7: 127,522,017	E174G	probably damaging	Het
Srgap2	C	A	1: 131,292,576		probably null	Het
Stxbp5	A	T	10: 9,812,341	Y405*	probably null	Het
Thsd4	C	T	9: 59,988,037	R710H	probably benign	Het
Trp53inp1	T	A	4: 11,165,130	D51E	probably benign	Het
Ttc41	A	G	10: 86,731,018	D516G	probably benign	Het
Uap1l1	A	G	2: 25,362,828	V400A	probably damaging	Het
Vit	T	C	17: 78,624,753	S430P	probably damaging	Het
Vmn1r9	T	A	6: 57,071,309	M123K	possibly damaging	Het
Vmn2r14	A	T	5: 109,221,518		probably null	Het
Vwa3a	A	G	7: 120,791,701	T746A	probably benign	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Xpot	G	T	10: 121,606,808	H495Q	probably damaging	Het
Zcchc6	A	T	13: 59,789,452	L775H	probably damaging	Het
Zfp109	T	C	7: 24,229,145	T288A	probably benign	Het
Zfp277	T	A	12: 40,363,153	E276V	probably damaging	Het
Zfp703	A	G	8: 26,978,701	D131G	probably benign	Het
Zfp985	T	A	4: 147,583,344	I223N	probably benign	Het
Zrsr1	T	C	11: 22,973,805	V193A	possibly damaging	Het
Zscan20	A	G	4: 128,588,165	I568T	possibly damaging	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
dodgers	UTSW	14	32977106	nonsense	probably null
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
Giants	UTSW	14	33070618	nonsense	probably null
gigantea	UTSW	14	32974154	critical splice donor site	probably null
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
popped	UTSW	14	32966399	missense	probably damaging	0.99
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
stretched	UTSW	14	33073535	nonsense	probably null
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1483:Wdfy4	UTSW	14	33100966	missense	probably benign	0.41
R1490:Wdfy4	UTSW	14	33152538	critical splice donor site	probably null
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4655:Wdfy4	UTSW	14	32989936	missense	probably damaging	0.98
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R5964:Wdfy4	UTSW	14	33106011	missense	probably damaging	1.00
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
R7888:Wdfy4	UTSW	14	33090963	missense
R7946:Wdfy4	UTSW	14	33070748	missense
R7946:Wdfy4	UTSW	14	33104115	missense
R7986:Wdfy4	UTSW	14	33104115	missense
R7990:Wdfy4	UTSW	14	33097795	missense
R8001:Wdfy4	UTSW	14	32973535	critical splice donor site	probably null
R8010:Wdfy4	UTSW	14	32971627	missense
R8015:Wdfy4	UTSW	14	33107747	missense
R8032:Wdfy4	UTSW	14	33029086	nonsense	probably null
R8041:Wdfy4	UTSW	14	33154008	critical splice donor site	probably null
R8090:Wdfy4	UTSW	14	33104115	missense
R8092:Wdfy4	UTSW	14	33104115	missense
R8112:Wdfy4	UTSW	14	33104115	missense
R8114:Wdfy4	UTSW	14	33104115	missense
R8115:Wdfy4	UTSW	14	33104115	missense
R8117:Wdfy4	UTSW	14	32977106	nonsense	probably null
R8117:Wdfy4	UTSW	14	33104115	missense
R8118:Wdfy4	UTSW	14	33104115	missense
R8140:Wdfy4	UTSW	14	33142360	missense
R8155:Wdfy4	UTSW	14	33162819	missense
R8163:Wdfy4	UTSW	14	33151588	missense
R8293:Wdfy4	UTSW	14	32974261	missense
R8325:Wdfy4	UTSW	14	32967487	missense
R8353:Wdfy4	UTSW	14	32973624	missense	probably benign
R8370:Wdfy4	UTSW	14	33093251	missense
R8437:Wdfy4	UTSW	14	33076375	missense
R8497:Wdfy4	UTSW	14	32966399	missense	probably damaging	0.99
R8545:Wdfy4	UTSW	14	33078301	missense	probably benign	0.01
R8671:Wdfy4	UTSW	14	32971765	splice site	probably benign
R8708:Wdfy4	UTSW	14	32967532	missense
R8747:Wdfy4	UTSW	14	33152654	missense
R8794:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R8846:Wdfy4	UTSW	14	33145148	missense
R8880:Wdfy4	UTSW	14	33073535	nonsense	probably null
R9109:Wdfy4	UTSW	14	33038747	splice site	probably null
R9131:Wdfy4	UTSW	14	33097850	missense
R9309:Wdfy4	UTSW	14	33095356	missense
R9349:Wdfy4	UTSW	14	33154039	missense
R9451:Wdfy4	UTSW	14	33133561	missense
R9563:Wdfy4	UTSW	14	32970876	missense
R9587:Wdfy4	UTSW	14	33047273	nonsense	probably null
R9599:Wdfy4	UTSW	14	33133471	missense
R9670:Wdfy4	UTSW	14	33047262	missense
R9718:Wdfy4	UTSW	14	33125936	missense
R9742:Wdfy4	UTSW	14	33088030	missense
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null
Z1177:Wdfy4	UTSW	14	33087985	missense

Predicted Primers

PCR Primer
(F):5'- ATGTGTTGATCACCTCACCGG -3'
(R):5'- CTGAAATCTAGGTTTCCTCTTGGG -3'

Sequencing Primer
(F):5'- GTGCATCTGGATCAGGAACC -3'
(R):5'- CCTCTTGGGGGCTGAGG -3'

Posted On

2016-03-17