Mutagenetix > Incidental Mutation

Incidental Mutation 'R4884:Espl1'

375588

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

041978-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4884 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102324070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 2071 (A2071V)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001335] [ENSMUST00000062492] [ENSMUST00000064924] [ENSMUST00000165671] [ENSMUST00000165717] [ENSMUST00000166658] [ENSMUST00000169637] [ENSMUST00000170627] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000001335

SMART Domains

Protein: ENSMUSP00000001335
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
SCOP:d1fxkc_	12	58	4e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000062492

SMART Domains

Protein: ENSMUSP00000126970
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064924
AA Change: A2071V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: A2071V

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165671

SMART Domains

Protein: ENSMUSP00000128526
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	75	2.2e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165717

SMART Domains

Protein: ENSMUSP00000132441
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	72	1.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166658

SMART Domains

Protein: ENSMUSP00000129178
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	22	143	8.6e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168805

Predicted Effect

probably benign
Transcript: ENSMUST00000169637

SMART Domains

Protein: ENSMUSP00000128263
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	1	58	3.4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170627

SMART Domains

Protein: ENSMUSP00000131245
Gene: ENSMUSG00000001289

Domain	Start	End	E-Value	Type
Pfam:Prefoldin	7	99	4.6e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229050
AA Change: A2071V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	T	6: 96,164,812	M417K	probably damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
4930452B06Rik	G	A	14: 8,578,394	T116I	probably damaging	Het
Aadat	C	T	8: 60,526,629	P175L	probably damaging	Het
Acot7	G	T	4: 152,186,207		probably benign	Het
Adad1	T	G	3: 37,076,664	F259V	possibly damaging	Het
Adora2a	A	G	10: 75,326,045	Y6C	probably null	Het
Ahnak	A	G	19: 9,012,754		probably benign	Het
Ankar	A	T	1: 72,698,807	M72K	probably damaging	Het
Ankrd45	A	G	1: 161,160,700	K176R	possibly damaging	Het
Ap3m2	T	C	8: 22,803,981	K18E	probably damaging	Het
Apol10b	C	T	15: 77,588,806	R16Q	possibly damaging	Het
Atp2b2	T	A	6: 113,842,186	T49S	possibly damaging	Het
B3gntl1	T	G	11: 121,629,969	Y206S	possibly damaging	Het
BC061237	G	A	14: 44,501,209	E22K	possibly damaging	Het
Bmp1	A	G	14: 70,475,215	V959A	probably benign	Het
C530008M17Rik	A	T	5: 76,848,835	I47F	probably damaging	Het
Cep295	T	C	9: 15,351,760	E169G	probably damaging	Het
Cfap65	T	G	1: 74,903,124	E1757A	possibly damaging	Het
Cgrrf1	T	A	14: 46,853,455	I216N	possibly damaging	Het
Clstn2	T	A	9: 97,799,395	D64V	probably damaging	Het
Col27a1	T	A	4: 63,275,960	D851E	possibly damaging	Het
Coq9	C	T	8: 94,853,194	P259L	probably benign	Het
Cps1	A	G	1: 67,177,024	N836S	probably benign	Het
Crebbp	T	C	16: 4,088,375	K1588E	probably damaging	Het
Cspg4	T	C	9: 56,898,069	W2055R	probably benign	Het
Cyp3a44	A	T	5: 145,777,982	M453K	probably damaging	Het
Dhx36	T	G	3: 62,484,260	D555A	probably damaging	Het
Dock2	A	T	11: 34,266,248	Y1219N	probably damaging	Het
Dpy19l2	A	T	9: 24,628,180	C492*	probably null	Het
Dusp22	A	G	13: 30,668,830	N16S	probably benign	Het
Epha1	A	G	6: 42,360,734	M805T	probably damaging	Het
Fam160a1	A	C	3: 85,683,611	C178G	probably damaging	Het
Fbxo11	T	A	17: 87,992,333	D863V	probably damaging	Het
Fbxo7	T	A	10: 86,029,150	Y106N	probably damaging	Het
Fst	A	G	13: 114,454,384	V282A	probably damaging	Het
Gfra3	T	A	18: 34,711,251	M79L	probably benign	Het
Glp1r	T	C	17: 30,936,266	V409A	probably damaging	Het
Gm10799	T	A	2: 104,068,207	D51V	probably damaging	Het
Gm572	C	A	4: 148,667,362	T228N	possibly damaging	Het
Grip1	C	T	10: 120,075,306	T643M	probably damaging	Het
Hdgfl2	C	T	17: 56,096,265	R222C	possibly damaging	Het
Hecw2	T	A	1: 53,950,841	I125F	probably benign	Het
Hipk1	A	G	3: 103,744,022	S1153P	possibly damaging	Het
Insm2	T	C	12: 55,599,761	S97P	probably damaging	Het
Iqca	A	G	1: 90,140,037	V164A	probably benign	Het
Kcna6	T	C	6: 126,738,726	D400G	probably benign	Het
Kctd1	T	C	18: 14,974,254	Y122C	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Klra2	T	C	6: 131,230,202	Y148C	probably damaging	Het
Krtap31-1	G	A	11: 99,908,484	C171Y	unknown	Het
Ldlrap1	C	T	4: 134,758,971	R59Q	probably benign	Het
Ltb	T	C	17: 35,195,258	I3T	probably benign	Het
Macf1	T	C	4: 123,455,009	I2477V	probably benign	Het
Mpdz	A	T	4: 81,361,476	I39N	probably damaging	Het
Mycbp2	A	G	14: 103,211,295	I1776T	probably damaging	Het
Myof	T	A	19: 37,942,357	E994V	probably damaging	Het
Myom3	A	G	4: 135,783,055	E553G	possibly damaging	Het
Mysm1	A	T	4: 94,958,948	C504S	probably damaging	Het
Nectin3	A	T	16: 46,448,886	H384Q	probably benign	Het
Net1	G	A	13: 3,884,252	R482*	probably null	Het
Nit1	T	C	1: 171,343,695	K193R	probably null	Het
Nlgn1	A	G	3: 25,912,674	V205A	probably damaging	Het
Nr3c2	A	T	8: 76,908,809	I180F	possibly damaging	Het
Nup62	T	A	7: 44,828,865	S101R	probably damaging	Het
Olfr1264	A	G	2: 90,021,643	V141A	probably benign	Het
Olfr1465	A	T	19: 13,313,670	I205N	probably benign	Het
Olfr1489	A	T	19: 13,634,027	K305N	probably benign	Het
Olfr155	T	C	4: 43,854,890	S194P	probably damaging	Het
Olfr355	G	T	2: 36,928,012	T34K	possibly damaging	Het
Olfr508	A	T	7: 108,630,612	I207F	probably damaging	Het
Olfr64	T	A	7: 103,893,655	I27F	probably benign	Het
Olfr663	T	A	7: 104,703,861	I98N	probably damaging	Het
Osbpl6	A	T	2: 76,549,539	I158F	probably damaging	Het
Pcbp4	A	G	9: 106,462,102	T103A	probably benign	Het
Pcdha2	T	A	18: 36,940,900	L528Q	probably damaging	Het
Pcdhga5	T	C	18: 37,694,627	S43P	probably damaging	Het
Pdgfra	C	A	5: 75,189,312	N952K	probably benign	Het
Pla2r1	A	G	2: 60,534,984	S81P	probably damaging	Het
Ppp1r32	A	T	19: 10,474,501	*428R	probably null	Het
Rabggtb	A	T	3: 153,911,931	D43E	possibly damaging	Het
Rexo5	T	A	7: 119,825,551	C43*	probably null	Het
Robo1	T	A	16: 72,904,751	D168E	probably damaging	Het
Scimp	A	G	11: 70,798,039	M49T	unknown	Het
Sema3e	T	A	5: 14,225,565	V228E	probably damaging	Het
Sema6d	A	G	2: 124,656,818		probably null	Het
Serpinb6d	A	T	13: 33,666,445	D85V	possibly damaging	Het
Slc24a2	C	T	4: 86,991,508	V658I	probably damaging	Het
Snd1	T	C	6: 28,526,912	I198T	possibly damaging	Het
Snx33	C	T	9: 56,926,180	V202M	probably damaging	Het
Soga3	A	T	10: 29,196,541	N610Y	probably damaging	Het
Srcap	A	G	7: 127,522,017	E174G	probably damaging	Het
Srgap2	C	A	1: 131,292,576		probably null	Het
Stxbp5	A	T	10: 9,812,341	Y405*	probably null	Het
Thsd4	C	T	9: 59,988,037	R710H	probably benign	Het
Trp53inp1	T	A	4: 11,165,130	D51E	probably benign	Het
Ttc41	A	G	10: 86,731,018	D516G	probably benign	Het
Uap1l1	A	G	2: 25,362,828	V400A	probably damaging	Het
Vit	T	C	17: 78,624,753	S430P	probably damaging	Het
Vmn1r9	T	A	6: 57,071,309	M123K	possibly damaging	Het
Vmn2r14	A	T	5: 109,221,518		probably null	Het
Vwa3a	A	G	7: 120,791,701	T746A	probably benign	Het
Wdfy4	G	T	14: 32,988,895	Y2578*	probably null	Het
Wdr53	A	T	16: 32,256,978	K334*	probably null	Het
Xpot	G	T	10: 121,606,808	H495Q	probably damaging	Het
Zcchc6	A	T	13: 59,789,452	L775H	probably damaging	Het
Zfp109	T	C	7: 24,229,145	T288A	probably benign	Het
Zfp277	T	A	12: 40,363,153	E276V	probably damaging	Het
Zfp703	A	G	8: 26,978,701	D131G	probably benign	Het
Zfp985	T	A	4: 147,583,344	I223N	probably benign	Het
Zrsr1	T	C	11: 22,973,805	V193A	possibly damaging	Het
Zscan20	A	G	4: 128,588,165	I568T	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGATGAGACCTGCCCTC -3'
(R):5'- GAGGTAGTCACACAGCTTCTACC -3'

Sequencing Primer
(F):5'- TGCACCTCTAAGCCAGGGAAG -3'
(R):5'- TACCATAGACAAGACAGCTTCAGGG -3'

Posted On

2016-03-17