Incidental Mutation 'R4884:Myof'
ID 375608
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms Fer1l3, E030042N20Rik, 2310051D19Rik
MMRRC Submission 041978-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4884 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 37899036-38043577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37942357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 994 (E994V)
Ref Sequence ENSEMBL: ENSMUSP00000153225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect possibly damaging
Transcript: ENSMUST00000041475
AA Change: E981V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: E981V

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172095
AA Change: E981V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: E981V

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224518
Predicted Effect probably damaging
Transcript: ENSMUST00000225159
AA Change: E465V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226068
AA Change: E994V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Aadat C T 8: 60,526,629 P175L probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cfap65 T G 1: 74,903,124 E1757A possibly damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cspg4 T C 9: 56,898,069 W2055R probably benign Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
R8116:Myof UTSW 19 37932719 missense probably damaging 0.99
R8264:Myof UTSW 19 37921433 missense probably damaging 1.00
R8415:Myof UTSW 19 37995424 missense probably benign
R8756:Myof UTSW 19 37939952 missense probably benign
R8777:Myof UTSW 19 37980393 missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37980393 missense probably benign 0.01
R8835:Myof UTSW 19 37967099 missense possibly damaging 0.92
R9396:Myof UTSW 19 37934846 missense probably damaging 1.00
R9415:Myof UTSW 19 37952964 missense probably damaging 1.00
R9450:Myof UTSW 19 37960926 missense probably damaging 1.00
R9451:Myof UTSW 19 37977648 critical splice donor site probably null
R9537:Myof UTSW 19 37907606 missense probably damaging 1.00
R9592:Myof UTSW 19 38043289 missense probably damaging 0.99
R9616:Myof UTSW 19 37934815 missense possibly damaging 0.52
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AACTCTGCACAGTGTGGCAG -3'
(R):5'- ATATTTGTGGCATTATGGCTCCC -3'

Sequencing Primer
(F):5'- TGTGGCAGGCAGAGCACTC -3'
(R):5'- GGCTCCCCAAAAATTTCAGTATGG -3'
Posted On 2016-03-17