Incidental Mutation 'R4885:Cr2'
ID 375613
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 042851-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R4885 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 194841039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 418 (I418F)
Ref Sequence ENSEMBL: ENSMUSP00000141538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000082321
AA Change: I418F

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: I418F

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect possibly damaging
Transcript: ENSMUST00000193356
AA Change: I121F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: I121F

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194149
Predicted Effect possibly damaging
Transcript: ENSMUST00000195120
AA Change: I418F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: I418F

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: I794F

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,370,425 (GRCm39) T317A probably benign Het
Adck1 G A 12: 88,407,865 (GRCm39) A199T probably benign Het
Adgrb1 A T 15: 74,444,011 (GRCm39) M1038L probably benign Het
Anapc10 C T 8: 80,455,779 (GRCm39) T76I probably benign Het
Atosa T C 9: 74,913,649 (GRCm39) L94P probably damaging Het
Bptf C T 11: 106,965,474 (GRCm39) S1177N probably benign Het
Bsn A T 9: 107,984,726 (GRCm39) Y337* probably null Het
Ccl20 T A 1: 83,095,580 (GRCm39) V48E possibly damaging Het
Ccnl1 C T 3: 65,864,320 (GRCm39) D122N probably damaging Het
Chat C G 14: 32,176,567 (GRCm39) G69A probably damaging Het
Dmxl1 G C 18: 50,011,862 (GRCm39) A1340P probably damaging Het
Eef2k G A 7: 120,491,155 (GRCm39) R547Q probably benign Het
Eml2 G A 7: 18,937,935 (GRCm39) S793N probably benign Het
Enox1 T A 14: 77,958,290 (GRCm39) L632Q probably damaging Het
Fabp9 T C 3: 10,259,738 (GRCm39) K92E probably damaging Het
Fam234a T C 17: 26,432,559 (GRCm39) H530R probably benign Het
Fancm C T 12: 65,149,417 (GRCm39) Q728* probably null Het
Fgd3 G A 13: 49,417,465 (GRCm39) T666M possibly damaging Het
Foxs1 T C 2: 152,774,301 (GRCm39) M251V probably benign Het
Fsip2 A T 2: 82,818,438 (GRCm39) M4724L probably benign Het
Gemin6 G A 17: 80,535,327 (GRCm39) E96K probably damaging Het
Gfi1 C A 5: 107,871,152 (GRCm39) V80F probably damaging Het
H3c13 G T 3: 96,176,277 (GRCm39) V90F possibly damaging Het
Hectd1 A G 12: 51,847,505 (GRCm39) V442A probably damaging Het
Ift80 A G 3: 68,857,829 (GRCm39) I272T probably damaging Het
Impact C G 18: 13,119,430 (GRCm39) A214G probably damaging Het
Insl6 C T 19: 29,302,556 (GRCm39) E54K probably benign Het
Irak3 T A 10: 120,018,586 (GRCm39) D54V probably damaging Het
Itk C T 11: 46,227,171 (GRCm39) probably null Het
Ivl A T 3: 92,479,718 (GRCm39) C116S probably benign Het
Kcnq4 G A 4: 120,570,260 (GRCm39) A361V probably benign Het
L1td1 C T 4: 98,625,548 (GRCm39) P581L probably benign Het
Lrp1b T C 2: 41,358,905 (GRCm39) E656G probably benign Het
Macrod2 A G 2: 140,261,985 (GRCm39) T89A possibly damaging Het
Mettl13 T C 1: 162,364,837 (GRCm39) D514G probably damaging Het
Mfsd13b A T 7: 120,590,711 (GRCm39) I151F possibly damaging Het
Mical3 G A 6: 120,912,214 (GRCm39) P1882S probably damaging Het
Mycbp2 T C 14: 103,383,382 (GRCm39) E394G possibly damaging Het
Myo16 T A 8: 10,488,892 (GRCm39) S688T probably damaging Het
Neb T C 2: 52,176,058 (GRCm39) Y1467C probably damaging Het
Nhsl3 C T 4: 129,118,238 (GRCm39) R214Q probably damaging Het
Nkx6-3 C A 8: 23,643,914 (GRCm39) P105Q possibly damaging Het
Nlrp1b T C 11: 71,108,710 (GRCm39) T264A possibly damaging Het
Nnat G A 2: 157,403,678 (GRCm39) C122Y probably damaging Het
Notch3 G A 17: 32,360,351 (GRCm39) R1527C probably damaging Het
Or2y16 C T 11: 49,335,449 (GRCm39) T257I probably damaging Het
Or5an1c T G 19: 12,218,082 (GRCm39) probably null Het
Or5h18 A G 16: 58,847,518 (GRCm39) Y251H probably damaging Het
Pds5b C T 5: 150,639,927 (GRCm39) T14I probably benign Het
Phf19 A T 2: 34,789,718 (GRCm39) I334N probably damaging Het
Pik3ap1 T C 19: 41,364,365 (GRCm39) D118G probably benign Het
Pkhd1 T A 1: 20,140,712 (GRCm39) E3886V possibly damaging Het
Pkp1 A G 1: 135,846,690 (GRCm39) S21P possibly damaging Het
Pramel32 T A 4: 88,546,219 (GRCm39) L374F possibly damaging Het
Rack1 C A 11: 48,696,463 (GRCm39) A290E probably damaging Het
Rbm15 A G 3: 107,239,570 (GRCm39) V276A probably benign Het
Rnf216 A T 5: 143,076,335 (GRCm39) L183* probably null Het
Sc5d T C 9: 42,166,922 (GRCm39) I206V probably benign Het
Scpep1 A G 11: 88,826,737 (GRCm39) I233T probably benign Het
Sh3pxd2a A G 19: 47,257,132 (GRCm39) Y529H probably damaging Het
Slc1a4 A C 11: 20,254,384 (GRCm39) V494G probably damaging Het
Slc38a7 T C 8: 96,575,230 (GRCm39) T17A probably benign Het
Smg6 T C 11: 74,932,744 (GRCm39) S73P probably damaging Het
Stk32b T C 5: 37,624,141 (GRCm39) Y202C probably damaging Het
Tas2r140 A G 6: 40,468,334 (GRCm39) S55G probably damaging Het
Tcf12 C T 9: 71,766,122 (GRCm39) G504S probably null Het
Ttc3 G C 16: 94,227,690 (GRCm39) probably null Het
Ttc3 T C 16: 94,220,324 (GRCm39) I568T probably damaging Het
Ttc41 T G 10: 86,594,966 (GRCm39) N913K possibly damaging Het
Vrk1 G A 12: 106,024,231 (GRCm39) V236M probably damaging Het
Wscd1 C T 11: 71,650,972 (GRCm39) R100C probably damaging Het
Zc3h18 C T 8: 123,128,445 (GRCm39) probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCTTACACTCTGCAACTAAGAAAGAG -3'
(R):5'- AGGAACCAAACAGCCTGAGT -3'

Sequencing Primer
(F):5'- CCAGACAATCTTGAGCAAAATATCTG -3'
(R):5'- CCAAACAGCCTGAGTATAGAAAAG -3'
Posted On 2016-03-17