Incidental Mutation 'R4885:Hectd1'
ID375657
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 042851-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51800722 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 442 (V442A)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: V442A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: V442A

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179265
AA Change: V443A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: V443A

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Meta Mutation Damage Score 0.7053 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Eml2 G A 7: 19,204,010 S793N probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Impact C G 18: 12,986,373 A214G probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Macrod2 A G 2: 140,420,065 T89A possibly damaging Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pik3ap1 T C 19: 41,375,926 D118G probably benign Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Vrk1 G A 12: 106,057,972 V236M probably damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7468:Hectd1 UTSW 12 51744805 synonymous probably null
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7925:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R8059:Hectd1 UTSW 12 51790378 missense not run
Predicted Primers PCR Primer
(F):5'- CGTGAAGCGTACACTTACCAG -3'
(R):5'- GCGTTTGGAACTCAGGAAATG -3'

Sequencing Primer
(F):5'- CTGACATGATGAGAACTGATCCTGC -3'
(R):5'- TTTGGAACTCAGGAAATGGTAAGCTG -3'
Posted On2016-03-17