Incidental Mutation 'R4885:Vrk1'
ID375660
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
MMRRC Submission 042851-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106057972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 236 (V236M)
Ref Sequence ENSEMBL: ENSMUSP00000152721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably damaging
Transcript: ENSMUST00000021539
AA Change: V236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: V236M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072040
AA Change: V236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: V236M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085026
AA Change: V236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: V236M

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220629
AA Change: V236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221312
AA Change: V236M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Eml2 G A 7: 19,204,010 S793N probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hectd1 A G 12: 51,800,722 V442A probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Impact C G 18: 12,986,373 A214G probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Macrod2 A G 2: 140,420,065 T89A possibly damaging Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pik3ap1 T C 19: 41,375,926 D118G probably benign Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTGAATCGACCTCCAAGGGATTG -3'
(R):5'- ACAGTCTGGTACCCCTGAAG -3'

Sequencing Primer
(F):5'- CAGTACTTTTCTGGTAATTCATGTGC -3'
(R):5'- TCTGGTACCCCTGAAGACCAGAG -3'
Posted On2016-03-17