Incidental Mutation 'R4885:Impact'
ID375673
Institutional Source Beutler Lab
Gene Symbol Impact
Ensembl Gene ENSMUSG00000024423
Gene Nameimpact, RWD domain protein
SynonymsE430016J11Rik
MMRRC Submission 042851-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12972252-12992948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 12986373 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 214 (A214G)
Ref Sequence ENSEMBL: ENSMUSP00000025290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025290]
Predicted Effect probably damaging
Transcript: ENSMUST00000025290
AA Change: A214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025290
Gene: ENSMUSG00000024423
AA Change: A214G

DomainStartEndE-ValueType
RWD 14 116 7.86e-29 SMART
low complexity region 126 139 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
Pfam:UPF0029 180 288 8.5e-36 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.5182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Eml2 G A 7: 19,204,010 S793N probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hectd1 A G 12: 51,800,722 V442A probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Macrod2 A G 2: 140,420,065 T89A possibly damaging Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pik3ap1 T C 19: 41,375,926 D118G probably benign Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Vrk1 G A 12: 106,057,972 V236M probably damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Impact
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Impact APN 18 12976019 missense probably benign 0.00
IGL01960:Impact APN 18 12974758 missense probably benign 0.13
R1056:Impact UTSW 18 12976524 missense probably benign 0.14
R1552:Impact UTSW 18 12984280 missense probably benign 0.25
R4111:Impact UTSW 18 12976033 critical splice donor site probably null
R4734:Impact UTSW 18 12985289 missense probably damaging 1.00
R5566:Impact UTSW 18 12974762 missense probably damaging 0.98
R5601:Impact UTSW 18 12976007 missense probably benign 0.44
R5966:Impact UTSW 18 12990544 missense probably benign 0.00
R6974:Impact UTSW 18 12982112 missense probably damaging 1.00
R7168:Impact UTSW 18 12986313 splice site probably null
R8108:Impact UTSW 18 12984331 missense probably benign 0.00
R8460:Impact UTSW 18 12976507 missense probably benign 0.00
R8474:Impact UTSW 18 12974741 missense probably damaging 1.00
R8897:Impact UTSW 18 12990494 missense probably benign 0.10
Z1177:Impact UTSW 18 12988366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTTTGCCCTACTACGGC -3'
(R):5'- CGTATCTAGTAGAGAACGCAGTGC -3'

Sequencing Primer
(F):5'- GCCCTACTACGGCACTTCAGAG -3'
(R):5'- AACGCAGTGCTCCTCCG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

R48850073_PCR_F: 5’- AAGGTTTGCCCTACTACGGC-3’

R48850073_PCR_R: 5’- CGTATCTAGTAGAGAACGCAGTGC-3’

 

Sequencing Primers

R48850073_SEQ_F: 5’- GCCCTACTACGGCACTTCAGAG-3’
 

R48850073_SEQ_R: 5’- AACGCAGTGCTCCTCCG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 400 nucleotides is amplified (NCBI RefSeq: NC_000084, chromosome 18. Chr13:12986167-12986566):

  

  1 aaggtttgcc ctactacggc acttcagagc ttaataaatt cactaagtaa ctgttctgct       

 61 ataaatttat atcaaattgc tttaattcta cctttctagc atttacagag aaaataaaag      

121 gcatatttgt ttatttctat tactgctgtt tttgaaggtg aaactggttc ttgccaagct      

181 gtacgagaat aagaagattg ccagcgccac ccacaacatc tatgcctaca ggtgagtgac      

241 tgccaggttt tacaataggc aatttacaaa cagttgctgg gaagctatgc aggattttga      

301 gatatagctg cttttttatt acaacagtag acctgtgaag tatttgaaaa ctgcagagag      

361 tcaagtagcc ggaggagcac tgcgttctct actagatacg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

Posted On2016-03-17