Mutagenetix > Incidental Mutation

Incidental Mutation 'R4885:Dmxl1'

375674

Institutional Source

Beutler Lab

Gene Symbol

Dmxl1

Ensembl Gene

ENSMUSG00000037416

Gene Name

Dmx-like 1

Synonyms

C630007L23Rik

MMRRC Submission

042851-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R4885 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49832670-49965473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 49878795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 1340 (A1340P)

Ref Sequence

ENSEMBL: ENSMUSP00000045559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041772
AA Change: A1340P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: A1340P

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
Pfam:Rav1p_C	1102	1877	4.3e-84	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2371	2385	N/A	INTRINSIC
low complexity region	2397	2410	N/A	INTRINSIC
low complexity region	2449	2466	N/A	INTRINSIC
WD40	2735	2770	1.07e1	SMART
WD40	2773	2813	3.7e0	SMART
WD40	2825	2867	1.07e0	SMART
WD40	2873	2912	1.05e-2	SMART
WD40	2915	2954	4.51e-7	SMART
Blast:WD40	2957	3005	9e-26	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180611
AA Change: A1340P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: A1340P

Domain	Start	End	E-Value	Type
WD40	100	136	8.22e1	SMART
WD40	156	195	2.88e-1	SMART
WD40	218	266	8.29e-1	SMART
low complexity region	367	378	N/A	INTRINSIC
WD40	464	505	1.53e2	SMART
Blast:WD40	719	772	1e-25	BLAST
WD40	957	999	1.1e1	SMART
low complexity region	1195	1206	N/A	INTRINSIC
low complexity region	1258	1271	N/A	INTRINSIC
Pfam:Rav1p_C	1287	1876	9.4e-72	PFAM
low complexity region	1922	1942	N/A	INTRINSIC
low complexity region	1966	1975	N/A	INTRINSIC
low complexity region	1993	2007	N/A	INTRINSIC
low complexity region	2147	2158	N/A	INTRINSIC
low complexity region	2385	2398	N/A	INTRINSIC
low complexity region	2437	2454	N/A	INTRINSIC
WD40	2723	2758	1.07e1	SMART
WD40	2761	2801	3.7e0	SMART
WD40	2813	2855	1.07e0	SMART
WD40	2861	2900	1.05e-2	SMART
WD40	2903	2942	4.51e-7	SMART
Blast:WD40	2945	2993	9e-26	BLAST

Meta Mutation Damage Score

0.3680

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	A	G	16: 20,551,675	T317A	probably benign	Het
Adck1	G	A	12: 88,441,095	A199T	probably benign	Het
Adgrb1	A	T	15: 74,572,162	M1038L	probably benign	Het
Anapc10	C	T	8: 79,729,150	T76I	probably benign	Het
Bptf	C	T	11: 107,074,648	S1177N	probably benign	Het
Bsn	A	T	9: 108,107,527	Y337*	probably null	Het
C77080	C	T	4: 129,224,445	R214Q	probably damaging	Het
C87499	T	A	4: 88,627,982	L374F	possibly damaging	Het
Ccl20	T	A	1: 83,117,859	V48E	possibly damaging	Het
Ccnl1	C	T	3: 65,956,899	D122N	probably damaging	Het
Chat	C	G	14: 32,454,610	G69A	probably damaging	Het
Cr2	T	A	1: 195,158,731	I418F	possibly damaging	Het
Eef2k	G	A	7: 120,891,932	R547Q	probably benign	Het
Eml2	G	A	7: 19,204,010	S793N	probably benign	Het
Enox1	T	A	14: 77,720,850	L632Q	probably damaging	Het
Fabp9	T	C	3: 10,194,678	K92E	probably damaging	Het
Fam214a	T	C	9: 75,006,367	L94P	probably damaging	Het
Fam234a	T	C	17: 26,213,585	H530R	probably benign	Het
Fancm	C	T	12: 65,102,643	Q728*	probably null	Het
Fgd3	G	A	13: 49,263,989	T666M	possibly damaging	Het
Foxs1	T	C	2: 152,932,381	M251V	probably benign	Het
Fsip2	A	T	2: 82,988,094	M4724L	probably benign	Het
Gemin6	G	A	17: 80,227,898	E96K	probably damaging	Het
Gfi1	C	A	5: 107,723,286	V80F	probably damaging	Het
Hectd1	A	G	12: 51,800,722	V442A	probably damaging	Het
Hist2h3b	G	T	3: 96,268,961	V90F	possibly damaging	Het
Ift80	A	G	3: 68,950,496	I272T	probably damaging	Het
Impact	C	G	18: 12,986,373	A214G	probably damaging	Het
Insl6	C	T	19: 29,325,156	E54K	probably benign	Het
Irak3	T	A	10: 120,182,681	D54V	probably damaging	Het
Itk	C	T	11: 46,336,344		probably null	Het
Ivl	A	T	3: 92,572,411	C116S	probably benign	Het
Kcnq4	G	A	4: 120,713,063	A361V	probably benign	Het
L1td1	C	T	4: 98,737,311	P581L	probably benign	Het
Lrp1b	T	C	2: 41,468,893	E656G	probably benign	Het
Macrod2	A	G	2: 140,420,065	T89A	possibly damaging	Het
Mettl13	T	C	1: 162,537,268	D514G	probably damaging	Het
Mfsd13b	A	T	7: 120,991,488	I151F	possibly damaging	Het
Mical3	G	A	6: 120,935,253	P1882S	probably damaging	Het
Mycbp2	T	C	14: 103,145,946	E394G	possibly damaging	Het
Myo16	T	A	8: 10,438,892	S688T	probably damaging	Het
Neb	T	C	2: 52,286,046	Y1467C	probably damaging	Het
Nkx6-3	C	A	8: 23,153,898	P105Q	possibly damaging	Het
Nlrp1b	T	C	11: 71,217,884	T264A	possibly damaging	Het
Nnat	G	A	2: 157,561,758	C122Y	probably damaging	Het
Notch3	G	A	17: 32,141,377	R1527C	probably damaging	Het
Olfr1388	C	T	11: 49,444,622	T257I	probably damaging	Het
Olfr186	A	G	16: 59,027,155	Y251H	probably damaging	Het
Olfr262	T	G	19: 12,240,718		probably null	Het
Pds5b	C	T	5: 150,716,462	T14I	probably benign	Het
Phf19	A	T	2: 34,899,706	I334N	probably damaging	Het
Pik3ap1	T	C	19: 41,375,926	D118G	probably benign	Het
Pkhd1	T	A	1: 20,070,488	E3886V	possibly damaging	Het
Pkp1	A	G	1: 135,918,952	S21P	possibly damaging	Het
Rack1	C	A	11: 48,805,636	A290E	probably damaging	Het
Rbm15	A	G	3: 107,332,254	V276A	probably benign	Het
Rnf216	A	T	5: 143,090,580	L183*	probably null	Het
Sc5d	T	C	9: 42,255,626	I206V	probably benign	Het
Scpep1	A	G	11: 88,935,911	I233T	probably benign	Het
Sh3pxd2a	A	G	19: 47,268,693	Y529H	probably damaging	Het
Slc1a4	A	C	11: 20,304,384	V494G	probably damaging	Het
Slc38a7	T	C	8: 95,848,602	T17A	probably benign	Het
Smg6	T	C	11: 75,041,918	S73P	probably damaging	Het
Stk32b	T	C	5: 37,466,797	Y202C	probably damaging	Het
Tas2r137	A	G	6: 40,491,400	S55G	probably damaging	Het
Tcf12	C	T	9: 71,858,840	G504S	probably null	Het
Ttc3	T	C	16: 94,419,465	I568T	probably damaging	Het
Ttc3	G	C	16: 94,426,831		probably null	Het
Ttc41	T	G	10: 86,759,102	N913K	possibly damaging	Het
Vrk1	G	A	12: 106,057,972	V236M	probably damaging	Het
Wscd1	C	T	11: 71,760,146	R100C	probably damaging	Het
Zc3h18	C	T	8: 122,401,706		probably benign	Het

Other mutations in Dmxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Dmxl1	APN	18	49851467	missense	probably damaging	1.00
IGL00668:Dmxl1	APN	18	49939553	missense	possibly damaging	0.64
IGL00740:Dmxl1	APN	18	49917668	missense	probably benign	0.00
IGL00969:Dmxl1	APN	18	49912725	missense	probably benign	0.02
IGL01113:Dmxl1	APN	18	49912751	missense	probably benign	0.01
IGL01384:Dmxl1	APN	18	49857334	missense	probably benign
IGL01475:Dmxl1	APN	18	49871714	missense	probably damaging	1.00
IGL01559:Dmxl1	APN	18	49920938	missense	probably damaging	0.99
IGL01578:Dmxl1	APN	18	49962205	missense	probably damaging	1.00
IGL01632:Dmxl1	APN	18	49863025	missense	probably damaging	0.99
IGL01814:Dmxl1	APN	18	49864868	missense	probably damaging	1.00
IGL01843:Dmxl1	APN	18	49878382	nonsense	probably null
IGL01933:Dmxl1	APN	18	49877785	missense	probably benign	0.17
IGL01952:Dmxl1	APN	18	49890654	missense	probably benign	0.11
IGL02120:Dmxl1	APN	18	49894178	missense	possibly damaging	0.83
IGL02162:Dmxl1	APN	18	49961163	missense	probably benign	0.00
IGL02213:Dmxl1	APN	18	49877674	splice site	probably benign
IGL02261:Dmxl1	APN	18	49840499	missense	possibly damaging	0.85
IGL02689:Dmxl1	APN	18	49864895	missense	probably damaging	1.00
IGL02892:Dmxl1	APN	18	49859120	missense	probably damaging	0.96
IGL03232:Dmxl1	APN	18	49878180	missense	probably benign	0.01
IGL03258:Dmxl1	APN	18	49920893	missense	probably damaging	1.00
IGL03298:Dmxl1	APN	18	49864818	missense	probably benign
capture	UTSW	18	49962261	missense	probably damaging	1.00
carnivora	UTSW	18	49864383	missense	probably damaging	0.99
digestion	UTSW	18	49878259	missense	probably damaging	1.00
drowning	UTSW	18	49878225	missense	possibly damaging	0.55
hibiscus	UTSW	18	49889467	missense	probably damaging	1.00
impound	UTSW	18	49893249	missense	probably benign
pitcher	UTSW	18	49864148	missense	probably damaging	1.00
PIT4810001:Dmxl1	UTSW	18	49931963	missense	probably damaging	1.00
R0001:Dmxl1	UTSW	18	49888897	splice site	probably benign
R0027:Dmxl1	UTSW	18	49957295	splice site	probably benign
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0042:Dmxl1	UTSW	18	49864035	missense	probably benign	0.03
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0046:Dmxl1	UTSW	18	49878082	missense	probably benign	0.22
R0257:Dmxl1	UTSW	18	49955803	splice site	probably benign
R0349:Dmxl1	UTSW	18	49879282	missense	probably damaging	0.99
R0390:Dmxl1	UTSW	18	49879362	missense	probably benign	0.14
R0511:Dmxl1	UTSW	18	49891467	nonsense	probably null
R0539:Dmxl1	UTSW	18	49857430	splice site	probably benign
R0542:Dmxl1	UTSW	18	49893694	missense	probably benign	0.05
R0587:Dmxl1	UTSW	18	49935307	missense	probably benign	0.39
R0635:Dmxl1	UTSW	18	49851423	splice site	probably benign
R0744:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0836:Dmxl1	UTSW	18	49833148	missense	probably damaging	1.00
R0845:Dmxl1	UTSW	18	49893402	missense	probably damaging	1.00
R1218:Dmxl1	UTSW	18	49893611	missense	probably damaging	1.00
R1278:Dmxl1	UTSW	18	49893225	missense	probably benign
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1313:Dmxl1	UTSW	18	49878483	missense	probably damaging	1.00
R1349:Dmxl1	UTSW	18	49888853	missense	probably damaging	1.00
R1453:Dmxl1	UTSW	18	49857249	missense	probably benign	0.05
R1522:Dmxl1	UTSW	18	49852367	missense	probably benign	0.05
R1629:Dmxl1	UTSW	18	49859286	critical splice donor site	probably null
R1638:Dmxl1	UTSW	18	49890767	nonsense	probably null
R1646:Dmxl1	UTSW	18	49962261	missense	probably damaging	1.00
R1719:Dmxl1	UTSW	18	49934637	missense	probably damaging	1.00
R1732:Dmxl1	UTSW	18	49893444	nonsense	probably null
R1732:Dmxl1	UTSW	18	49902988	missense	probably benign
R1886:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1887:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R1895:Dmxl1	UTSW	18	49955914	splice site	probably null
R1911:Dmxl1	UTSW	18	49878163	missense	probably benign	0.00
R2020:Dmxl1	UTSW	18	49889558	nonsense	probably null
R2116:Dmxl1	UTSW	18	49878817	missense	probably damaging	1.00
R2196:Dmxl1	UTSW	18	49917631	missense	probably benign	0.00
R2206:Dmxl1	UTSW	18	49894094	missense	probably benign	0.12
R2216:Dmxl1	UTSW	18	49893923	missense	probably benign	0.00
R2255:Dmxl1	UTSW	18	49846639	missense	probably benign	0.34
R2333:Dmxl1	UTSW	18	49919976	splice site	probably null
R2343:Dmxl1	UTSW	18	49890678	missense	probably damaging	1.00
R2496:Dmxl1	UTSW	18	49880791	missense	possibly damaging	0.51
R3757:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3758:Dmxl1	UTSW	18	49935317	missense	probably damaging	0.98
R3783:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3786:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3787:Dmxl1	UTSW	18	49865122	missense	probably damaging	1.00
R3885:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3886:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3887:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3888:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R3889:Dmxl1	UTSW	18	49878259	missense	probably damaging	1.00
R4014:Dmxl1	UTSW	18	49863962	missense	probably benign
R4033:Dmxl1	UTSW	18	49851431	missense	possibly damaging	0.95
R4096:Dmxl1	UTSW	18	49961197	missense	probably damaging	1.00
R4366:Dmxl1	UTSW	18	49878017	nonsense	probably null
R4406:Dmxl1	UTSW	18	49889553	missense	probably damaging	1.00
R4412:Dmxl1	UTSW	18	49848761	missense	probably benign
R4454:Dmxl1	UTSW	18	49893332	missense	probably benign	0.01
R4459:Dmxl1	UTSW	18	49961216	missense	possibly damaging	0.80
R4569:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4570:Dmxl1	UTSW	18	49852360	missense	probably damaging	1.00
R4606:Dmxl1	UTSW	18	49962181	missense	probably damaging	0.98
R4649:Dmxl1	UTSW	18	49878631	missense	probably damaging	0.99
R4683:Dmxl1	UTSW	18	49878021	missense	probably damaging	1.00
R4782:Dmxl1	UTSW	18	49862992	missense	probably damaging	1.00
R4878:Dmxl1	UTSW	18	49851476	missense	probably damaging	1.00
R4879:Dmxl1	UTSW	18	49889467	missense	probably damaging	1.00
R4881:Dmxl1	UTSW	18	49957281	intron	probably benign
R4916:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5022:Dmxl1	UTSW	18	49895127	missense	probably damaging	0.99
R5056:Dmxl1	UTSW	18	49870923	missense	probably benign	0.00
R5177:Dmxl1	UTSW	18	49893584	missense	probably damaging	0.99
R5342:Dmxl1	UTSW	18	49951235	missense	probably damaging	0.96
R5421:Dmxl1	UTSW	18	49863119	critical splice donor site	probably null
R5433:Dmxl1	UTSW	18	49867899	splice site	probably null
R5484:Dmxl1	UTSW	18	49889464	missense	probably damaging	1.00
R5598:Dmxl1	UTSW	18	49864478	missense	probably benign	0.04
R5633:Dmxl1	UTSW	18	49877697	missense	probably damaging	1.00
R5638:Dmxl1	UTSW	18	49891626	missense	possibly damaging	0.95
R5694:Dmxl1	UTSW	18	49894257	missense	probably damaging	1.00
R5696:Dmxl1	UTSW	18	49931941	nonsense	probably null
R5706:Dmxl1	UTSW	18	49957395	critical splice donor site	probably null
R5745:Dmxl1	UTSW	18	49846586	missense	probably benign
R5876:Dmxl1	UTSW	18	49870984	missense	possibly damaging	0.70
R6054:Dmxl1	UTSW	18	49857386	missense	probably benign	0.00
R6145:Dmxl1	UTSW	18	49912766	missense	possibly damaging	0.90
R6189:Dmxl1	UTSW	18	49893335	missense	probably benign	0.33
R6213:Dmxl1	UTSW	18	49863015	missense	possibly damaging	0.93
R6219:Dmxl1	UTSW	18	49902367	missense	probably damaging	0.99
R6221:Dmxl1	UTSW	18	49871732	missense	probably damaging	0.96
R6276:Dmxl1	UTSW	18	49846586	missense	probably benign
R6319:Dmxl1	UTSW	18	49852300	missense	probably benign	0.00
R6426:Dmxl1	UTSW	18	49864578	missense	probably damaging	0.99
R6567:Dmxl1	UTSW	18	49859179	missense	probably damaging	0.99
R6739:Dmxl1	UTSW	18	49878246	missense	probably benign	0.03
R6743:Dmxl1	UTSW	18	49880780	missense	possibly damaging	0.95
R6776:Dmxl1	UTSW	18	49893974	missense	probably damaging	1.00
R6827:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6828:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6829:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6830:Dmxl1	UTSW	18	49921024	missense	probably damaging	1.00
R6833:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6834:Dmxl1	UTSW	18	49955823	missense	probably damaging	0.99
R6856:Dmxl1	UTSW	18	49852288	nonsense	probably null
R6857:Dmxl1	UTSW	18	49864835	missense	probably damaging	0.99
R6881:Dmxl1	UTSW	18	49935305	missense	probably benign	0.00
R6882:Dmxl1	UTSW	18	49843784	critical splice acceptor site	probably null
R6892:Dmxl1	UTSW	18	49920902	missense	probably damaging	0.98
R6897:Dmxl1	UTSW	18	49851495	missense	probably null	0.99
R6897:Dmxl1	UTSW	18	49863057	missense	possibly damaging	0.51
R6917:Dmxl1	UTSW	18	49864148	missense	probably damaging	1.00
R7192:Dmxl1	UTSW	18	49955853	missense	probably damaging	0.99
R7447:Dmxl1	UTSW	18	49864614	missense	probably damaging	0.99
R7460:Dmxl1	UTSW	18	49878612	missense	probably benign	0.00
R7570:Dmxl1	UTSW	18	49893957	missense	possibly damaging	0.82
R7626:Dmxl1	UTSW	18	49902794	missense	probably benign
R7629:Dmxl1	UTSW	18	49859270	missense	probably damaging	1.00
R7644:Dmxl1	UTSW	18	49893552	missense	probably benign
R7688:Dmxl1	UTSW	18	49955871	missense	probably benign	0.03
R7689:Dmxl1	UTSW	18	49846618	missense	probably benign	0.00
R7712:Dmxl1	UTSW	18	49893461	missense	probably damaging	0.99
R7808:Dmxl1	UTSW	18	49878315	missense	probably benign	0.00
R7834:Dmxl1	UTSW	18	49920977	missense	probably damaging	1.00
R7848:Dmxl1	UTSW	18	49840490	missense	possibly damaging	0.88
R7849:Dmxl1	UTSW	18	49961147	missense	probably benign	0.00
R7881:Dmxl1	UTSW	18	49864383	missense	probably damaging	0.99
R7884:Dmxl1	UTSW	18	49893407	missense	possibly damaging	0.65
R8073:Dmxl1	UTSW	18	49878433	missense	probably damaging	1.00
R8089:Dmxl1	UTSW	18	49888830	missense	probably damaging	0.99
R8266:Dmxl1	UTSW	18	49843811	missense	probably benign	0.17
R8371:Dmxl1	UTSW	18	49898714	missense	probably benign	0.08
R8402:Dmxl1	UTSW	18	49878326	nonsense	probably null
R8402:Dmxl1	UTSW	18	49878327	missense	probably benign	0.09
R8402:Dmxl1	UTSW	18	49878342	missense	probably benign
R8423:Dmxl1	UTSW	18	49865116	missense	probably damaging	1.00
R8678:Dmxl1	UTSW	18	49871692	nonsense	probably null
R8702:Dmxl1	UTSW	18	49859135	missense	probably benign	0.09
R8749:Dmxl1	UTSW	18	49955870	missense	probably damaging	1.00
R8813:Dmxl1	UTSW	18	49957339	missense	probably damaging	0.99
R8877:Dmxl1	UTSW	18	49878225	missense	possibly damaging	0.55
R8945:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R8971:Dmxl1	UTSW	18	49864508	missense	possibly damaging	0.96
R8971:Dmxl1	UTSW	18	49893674	missense	probably damaging	1.00
R8978:Dmxl1	UTSW	18	49922612	missense	probably benign	0.37
R8987:Dmxl1	UTSW	18	49893852	missense
R9011:Dmxl1	UTSW	18	49864173	missense	probably damaging	1.00
R9124:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9131:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9132:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9156:Dmxl1	UTSW	18	49939572	missense	probably damaging	1.00
R9165:Dmxl1	UTSW	18	49878925	missense	probably damaging	1.00
R9244:Dmxl1	UTSW	18	49893249	missense	probably benign
R9254:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.67
R9262:Dmxl1	UTSW	18	49843852	missense	probably benign	0.03
R9335:Dmxl1	UTSW	18	49859120	missense	probably damaging	0.96
R9375:Dmxl1	UTSW	18	49958410	missense	probably damaging	1.00
R9379:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.67
R9434:Dmxl1	UTSW	18	49877721	missense	probably damaging	0.98
R9470:Dmxl1	UTSW	18	49893710	missense	possibly damaging	0.69
R9500:Dmxl1	UTSW	18	49878204	missense	probably damaging	1.00
R9507:Dmxl1	UTSW	18	49891500	missense	possibly damaging	0.94
R9617:Dmxl1	UTSW	18	49865161	missense	probably damaging	1.00
R9642:Dmxl1	UTSW	18	49880758	missense	probably damaging	1.00
RF009:Dmxl1	UTSW	18	49893394	missense	probably damaging	0.96
X0025:Dmxl1	UTSW	18	49864368	missense	probably damaging	0.98
X0066:Dmxl1	UTSW	18	49919899	missense	probably damaging	1.00
Z1088:Dmxl1	UTSW	18	49920965	missense	probably benign
Z1188:Dmxl1	UTSW	18	49868003	missense	probably damaging	0.96
Z1189:Dmxl1	UTSW	18	49868003	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCGATCCATGACCAGTCTTGC -3'
(R):5'- ATCATCTGCTGCAAGTAAGGCG -3'

Sequencing Primer
(F):5'- TGACCAGTCTTGCACAGAAAATC -3'
(R):5'- CTGCTGCAAGTAAGGCGTACAAAG -3'

Posted On

2016-03-17