Incidental Mutation 'R4885:Pik3ap1'
ID375677
Institutional Source Beutler Lab
Gene Symbol Pik3ap1
Ensembl Gene ENSMUSG00000025017
Gene Namephosphoinositide-3-kinase adaptor protein 1
SynonymsBCAP, 1810044J04Rik
MMRRC Submission 042851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41274218-41385070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41375926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 118 (D118G)
Ref Sequence ENSEMBL: ENSMUSP00000052777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059672]
Predicted Effect probably benign
Transcript: ENSMUST00000059672
AA Change: D118G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: D118G

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Meta Mutation Damage Score 0.1383 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Eml2 G A 7: 19,204,010 S793N probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hectd1 A G 12: 51,800,722 V442A probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Impact C G 18: 12,986,373 A214G probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Macrod2 A G 2: 140,420,065 T89A possibly damaging Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Vrk1 G A 12: 106,057,972 V236M probably damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Pik3ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Canvasback UTSW 19 41321630 missense possibly damaging 0.80
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
R7135:Pik3ap1 UTSW 19 41332321 missense probably damaging 1.00
R7162:Pik3ap1 UTSW 19 41321526 missense probably benign 0.03
R7175:Pik3ap1 UTSW 19 41287490 missense probably damaging 0.98
R7313:Pik3ap1 UTSW 19 41296376 missense possibly damaging 0.93
R7664:Pik3ap1 UTSW 19 41321630 missense possibly damaging 0.80
R7786:Pik3ap1 UTSW 19 41321585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACCAGATCTTTCCAAAG -3'
(R):5'- AGGATCTTTTCGTGTCCTGC -3'

Sequencing Primer
(F):5'- TTATAGCACGATGACCAATGTTC -3'
(R):5'- TTCGTAGCCAGAAGACGC -3'
Posted On2016-03-17